Recombinant Enterococcus faecalis Protein FsrB (fsrB)

What is FsrB and what role does it play in bacterial quorum sensing?

FsrB is a membrane protein encoded by the fsrB gene within the fsr locus of Enterococcus faecalis. It functions as a key component in the Fsr quorum-sensing system, which allows bacteria to regulate gene expression based on population density. The fsr locus comprises four genes: fsrA, fsrB, fsrD, and fsrC, whose products form a regulatory system that responds to the extracellular accumulation of gelatinase biosynthesis-activating pheromone (GBAP) . FsrB specifically belongs to the accessory gene regulator protein B (AgrB) family and serves both as a cysteine protease-like enzyme responsible for post-translational processing of the FsrD propeptide to generate mature GBAP and potentially as a membrane transporter for GBAP export .

The Fsr system functions similarly to the Agr system in Staphylococcus aureus, where accumulation of GBAP in the extracellular environment is sensed by FsrC, which then phosphorylates the response regulator FsrA . This two-component system ultimately controls the expression of virulence factors, including gelatinase (GelE), serine protease (SprE), and enterocin O16 . Through this mechanism, FsrB contributes significantly to E. faecalis pathogenicity by facilitating cell-to-cell communication that coordinates virulence factor expression in a population density-dependent manner.

How does the structure of FsrB relate to its function?

FsrB exhibits a predominantly α-helical structure as demonstrated by far-UV CD measurements . This structural characteristic is consistent with its role as a membrane protein and provides the framework for its dual functionality. The protein's secondary structure displays a small level of conformational flexibility, which may be important for its interactions with the FsrD propeptide during processing and with mature GBAP during signaling .

When FsrB (80 μM) interacts with GBAP (400 μM), the binding stabilizes FsrB's secondary structure, as evidenced by thermal denaturation studies that revealed melting temperatures of 70.1°C in the presence of GBAP compared to 60.8°C in its absence . This significant increase in thermal stability (approximately 9.3°C) confirms direct GBAP interactions with FsrB. The binding also induces tertiary structural changes in FsrB, further supporting its role as a GBAP receptor or transporter .

The protein's structural elements likely facilitate its cysteine protease activity for FsrD processing while also enabling it to function as a potential membrane transporter for GBAP export. Understanding these structure-function relationships is crucial for researchers attempting to target FsrB for antimicrobial development or studying quorum-sensing mechanisms in enterococci.

What experimental methods are commonly used to study FsrB?

Researchers employ several key experimental approaches to study FsrB:

• Genetic manipulation techniques: Creating nonpolar deletion mutants of fsrB and complementation strains has been fundamental to understanding its role in virulence . This typically involves PCR amplification of the fsrB gene, cloning into expression vectors like pTTQ18His, and transformation into E. faecalis .

• Protein expression and purification: The fsrB gene can be cloned into expression plasmids without the fsrD gene for recombinant production . Researchers have successfully employed primers (such as FsrB-F: 5′‐CCGGAATTCCCTAATCGATTGGATTCTAAAAAATATTATGG‐3′ and FsrB-R: 5′‐AAAACTGCAGCTGCAAAAACACTTCCTTCAATTAAATTTTTTG‐3′) to amplify the fsrB gene from E. faecalis V583 genomic DNA .

• Structural analysis: Far-UV CD measurements are used to analyze FsrB's secondary structure, while thermal denaturation studies help assess protein stability and interactions with GBAP .

• In vivo infection models: The rabbit endophthalmitis model has been particularly valuable for exploring FsrB's role in pathogenicity . Other models include Caenorhabditis elegans, Arabidopsis thaliana, mouse models, and endocarditis models .

• Gene expression analysis: Techniques such as quantitative PCR are used to measure the expression of genes regulated by the Fsr system, including gelE, sprE, and ef1097, which helps elucidate FsrB's role in the regulatory network .

These methodologies have collectively advanced our understanding of FsrB's structure, function, and significance in E. faecalis virulence regulation.

What are the optimal conditions for recombinant expression and purification of FsrB?

Recombinant expression and purification of FsrB presents several challenges due to its nature as a membrane protein. Based on published protocols, researchers should consider the following methodological approach:

Expression system selection: The fsrB gene from E. faecalis V583 can be successfully cloned into expression plasmids such as pTTQ18His, which provides a C-terminal hexahistidine tag for purification . When designing primers for amplification, it's critical to exclude the fsrD gene that occurs in-frame with and just downstream of fsrB to avoid co-expression complications .

Restriction site design: The use of specific restriction enzymes such as EcoRI and PstI has been documented for successful cloning of fsrB . The primers should incorporate these restriction sites for directional cloning (e.g., FsrB-F: 5′‐CCGGAATTCCCTAATCGATTGGATTCTAAAAAATATTATGG‐3′ and FsrB-R: 5′‐AAAACTGCAGCTGCAAAAACACTTCCTTCAATTAAATTTTTTG‐3′) .

Expression optimization: Since FsrB is a membrane protein, expression in E. coli often requires optimization of induction conditions, including IPTG concentration, temperature, and duration. Lower temperatures (16-20°C) and longer induction times may improve proper folding and membrane insertion.

Membrane protein extraction: Effective solubilization of FsrB from membranes requires careful selection of detergents. A two-step solubilization process involving initial membrane isolation followed by detergent extraction (using detergents like DDM, LDAO, or C12E8) is recommended.

Purification strategy: Immobilized metal affinity chromatography (IMAC) using the hexahistidine tag is effective for initial purification, followed by size exclusion chromatography for higher purity. Throughout all purification steps, maintaining an appropriate detergent concentration above its critical micelle concentration is essential to prevent protein aggregation.

Functional verification: Post-purification, FsrB functionality can be assessed through binding assays with GBAP using techniques such as thermal stability assays, where a shift in melting temperature indicates successful binding .

How can researchers effectively assess the interaction between FsrB and GBAP?

Investigating the interaction between FsrB and GBAP requires sophisticated biophysical and biochemical approaches:

Thermal stability assays: Differential scanning calorimetry or circular dichroism can measure shifts in the melting temperature of FsrB in the presence and absence of GBAP. Research has demonstrated that GBAP (400 μM) stabilizes FsrB (80 μM), increasing its melting temperature from 60.8°C to 70.1°C .

Circular dichroism spectroscopy: This technique provides valuable insights into conformational changes in FsrB upon GBAP binding. Far-UV CD measurements have shown that GBAP binding stabilizes FsrB's predominantly α-helical secondary structure .

Fluorescence-based binding assays: Intrinsic tryptophan fluorescence or extrinsic fluorescent probes can detect conformational changes in FsrB upon GBAP binding. These assays can be adapted to determine binding kinetics and affinity constants.

Isothermal titration calorimetry (ITC): For quantitative binding parameters, ITC can directly measure the thermodynamic properties of the FsrB-GBAP interaction, providing binding constants, stoichiometry, and thermodynamic profiles.

Surface plasmon resonance (SPR): This label-free technology can measure real-time binding kinetics between immobilized FsrB and GBAP in solution, offering association and dissociation rate constants.

Microscale thermophoresis (MST): This emerging technique detects changes in the hydration shell, charge, or size of molecules during binding and requires minimal sample amounts, making it valuable for challenging membrane proteins like FsrB.

Cross-linking studies: Chemical cross-linking followed by mass spectrometry can identify specific amino acid residues involved in the FsrB-GBAP interaction, providing structural insights into the binding interface.

These complementary approaches collectively provide a comprehensive characterization of the FsrB-GBAP interaction, which is fundamental to understanding the molecular mechanisms of quorum sensing in E. faecalis.

What strategies can be employed to investigate FsrB's dual role in GBAP processing and transport?

Investigating FsrB's dual functionality requires sophisticated experimental approaches that can distinguish between its protease activity and transport function:

Site-directed mutagenesis: By creating point mutations in predicted catalytic residues (for protease activity) or putative transport domains, researchers can separate the two functions of FsrB. Mutations should be designed based on sequence homology with other AgrB-like proteins, focusing on conserved cysteine residues potentially involved in proteolytic activity .

In vitro processing assays: Using purified FsrB and synthetic FsrD propeptide, researchers can assess the conversion of propeptide to mature GBAP through HPLC or mass spectrometry. This approach allows for direct measurement of FsrB's protease activity under controlled conditions.

Membrane vesicle transport assays: To study FsrB's transport function, inside-out membrane vesicles containing recombinant FsrB can be prepared and used to measure GBAP transport rates across membranes. This can be coupled with radioactively or fluorescently labeled GBAP to track movement.

Protease activity inhibition: Selective inhibitors of cysteine proteases can be employed to block FsrB's processing activity while potentially leaving transport functions intact. This approach helps differentiate between the two functions in vivo.

Chimeric protein construction: Creating chimeric proteins where domains of FsrB are exchanged with corresponding regions from other AgrB-like proteins with known function can help map functional domains responsible for protease activity versus transport.

Biolayer interferometry: This technique can measure the kinetics of FsrB-FsrD and FsrB-GBAP interactions, providing insights into substrate binding for both processing and transport functions.

Computational modeling: Molecular dynamics simulations of FsrB embedded in a lipid bilayer can predict conformational changes associated with GBAP transport, generating testable hypotheses about the transport mechanism.

These multifaceted approaches collectively can disentangle FsrB's dual roles, advancing our understanding of quorum-sensing mechanics in E. faecalis and potentially identifying specific targets for antimicrobial development.

How does FsrB contribute to E. faecalis virulence in different infection models?

FsrB plays a crucial role in E. faecalis virulence across multiple infection models, demonstrating its significance in pathogenicity:

Rabbit endophthalmitis model: Studies using this model have shown that nonpolar deletion mutants of fsrB exhibit significantly reduced virulence compared to wild-type strains . Specifically, fsrB-positive strains caused a substantial reduction in retinal function (measured by B-wave amplitude) compared to fsrB-negative strains . Complementation of the mutation restored virulence, confirming fsrB's direct role in pathogenesis .

Caenorhabditis elegans model: The nematode C. elegans feeding on lawns containing E. faecalis with functional fsrB developed lethal infections, whereas fsrB mutant strains showed attenuated virulence . This demonstrates fsrB's contribution to persistent infection even in invertebrate models.

Arabidopsis thaliana model: In plant models, parental E. faecalis strain OG1RF caused mortality within 7 days post-inoculation, while fsrB mutant strains significantly attenuated virulence and reduced aerial tissue damage .

Murine models: In mouse models of peritonitis and systemic infection, fsrB's role in regulating gelatinase production contributed significantly to pathogenicity . The gelE-positive phenotype, which is regulated by the Fsr system, increased bacterial burden in tissues during infection.

Endocarditis models: The fsr locus has shown a higher prevalence in endocarditis isolates (100%) compared to fecal isolates (53%), highlighting its importance in this serious infection .

The contribution of FsrB to virulence stems from its role in the Fsr quorum-sensing system, which regulates the expression of important virulence factors including gelatinase (GelE), serine protease (SprE), and enterocin O16 . These factors collectively facilitate tissue invasion, immune evasion, and competitive advantage in host environments. The fsrB gene's consistent involvement across diverse infection models underscores its fundamental importance to E. faecalis pathogenicity.

What is the relationship between FsrB and other components of the Fsr quorum-sensing system?

FsrB operates within an intricate network of interactions with other components of the Fsr quorum-sensing system:

FsrB-FsrD interaction: FsrB processes the FsrD propeptide (encoded by the fsrD gene) to generate mature GBAP, which serves as the quorum-sensing signal molecule . This proteolytic processing is a critical first step in the signaling cascade.

FsrB-GBAP interaction: After processing FsrD, FsrB likely facilitates the export of mature GBAP across the cytoplasmic membrane . Additionally, purified FsrB directly binds to GBAP, which stabilizes its structure and increases its thermal stability, suggesting a continued role for FsrB beyond initial processing .

GBAP-FsrC interaction: Once exported, GBAP accumulates in the extracellular environment and is sensed by FsrC, a transmembrane histidine protein kinase that functions as the sensor-transmitter of the fsr operon . This interaction triggers FsrC autophosphorylation.

FsrC-FsrA interaction: Phosphorylated FsrC transfers its phosphate group to FsrA, a response regulator belonging to the LytTR family of DNA-binding proteins . This phosphorylation activates FsrA for DNA binding.

FsrA-DNA interaction: Activated FsrA binds to specific DNA sequences found in the promoter regions of target genes. FsrA recognizes two imperfect direct repeats separated by 13 bp with the consensus sequence T/AT/CAA/GGGAA/G . This binding regulates transcription of fsrBDC, gelE-sprE operons, and the ef1097 locus .

The integrated operation of this system creates a feedback loop: as E. faecalis population density increases, GBAP concentration rises, leading to enhanced FsrA activation and increased transcription of fsrBDC, which produces more FsrB and FsrD, generating more GBAP. This positive feedback amplifies the quorum-sensing response and coordinates virulence factor expression across the bacterial population. Mutations in any component of this system disrupt the signaling cascade, as evidenced by studies showing that deletion of fsrA, fsrB, or fsrC abolished the expressions of gelE and sprE completely .

What is the relationship between the Fsr system and disease in various host models?

The Fsr quorum-sensing system has been extensively studied in various disease models, demonstrating its critical role in E. faecalis pathogenicity across different hosts:

These findings collectively demonstrate the Fsr system's prominent role in E. faecalis pathogenicity across diverse host environments. The system's contribution to virulence primarily operates through its regulation of key virulence factors, particularly gelatinase (GelE) and serine protease (SprE). The functional Fsr system enables E. faecalis to adapt to various host tissues and overcome host defense mechanisms, making it a critical determinant of disease severity and progression in multiple infection models .

How can FsrB be targeted for antimicrobial development?

FsrB represents a promising target for novel antimicrobial strategies due to its critical role in E. faecalis quorum sensing and virulence regulation. Several approaches can be employed to target FsrB for therapeutic development:

Small molecule inhibitors: Designing inhibitors that specifically target FsrB's protease activity could prevent GBAP production, thereby disrupting quorum sensing . Structure-based drug design approaches can utilize knowledge of FsrB's predominantly α-helical structure to develop compounds that interfere with its catalytic activity without affecting beneficial microbiota .

Peptide mimetics: Since FsrB processes the FsrD propeptide, competitive peptide mimetics that occupy FsrB's active site without being processed could effectively block its function. These peptides could be designed based on the FsrD sequence with modifications to prevent cleavage.

GBAP binding interference: Compounds that compete with GBAP for binding to FsrB could disrupt the stabilizing effect of this interaction . Targeting the GBAP-binding pocket of FsrB with small molecules could prevent GBAP export or processing, effectively attenuating virulence.

Anti-FsrB antibodies: Therapeutic antibodies or antibody fragments could be engineered to recognize extracellular portions of FsrB, potentially interfering with its function in membrane transport or GBAP processing.

Antisense strategies: Antisense oligonucleotides or RNA interference approaches targeting fsrB mRNA could reduce FsrB expression, thereby attenuating virulence without killing the bacteria, which may reduce selective pressure for resistance development.

CRISPR-Cas targeting: Novel CRISPR-Cas antimicrobials could be designed to specifically target and inactivate the fsrB gene in E. faecalis, potentially creating a selective antimicrobial with minimal impact on commensal microbiota.

These approaches aim to attenuate virulence rather than kill bacteria outright, potentially reducing selective pressure for resistance development. Since fsrB mutation significantly reduces virulence without eliminating the bacteria completely, these anti-virulence strategies may allow host defenses to clear infections more effectively while minimizing disruption to the microbiome .

What experimental approaches can be used to screen for FsrB inhibitors?

Developing effective screening assays for FsrB inhibitors requires strategies that can detect interference with its dual functions in GBAP processing and transport:

FsrB protease activity assays: High-throughput fluorescence-based assays using synthetic peptide substrates containing the FsrD cleavage site coupled to quenched fluorophores can detect inhibition of FsrB's proteolytic activity. Cleavage releases the fluorophore, and inhibitors will prevent fluorescence increase.

GBAP production monitoring: A reporter strain of E. faecalis with a fluorescent or luminescent gene fused to a GBAP-responsive promoter (such as gelE) can detect compounds that inhibit GBAP production or activity in a cell-based assay. Effective inhibitors would reduce reporter signal.

Thermal shift assays: Differential scanning fluorimetry can measure FsrB's thermal stability in the presence of potential inhibitors. Compounds binding to FsrB may alter its melting temperature, providing a relatively simple screening approach for binding interactions .

Membrane transport assays: Membrane vesicles containing reconstituted FsrB can be used to measure GBAP transport. Transport inhibitors would reduce GBAP movement across the membrane, detectable with fluorescently labeled GBAP.

Surface plasmon resonance screening: Medium-throughput screening of compound libraries against immobilized FsrB can identify binding molecules based on changes in refractive index, which can be further characterized for their effects on FsrB function.

Virtual screening: In silico methods can screen large virtual compound libraries against structural models of FsrB, especially targeting predicted binding sites or catalytic domains. Top hits can then be validated experimentally.

Phenotypic virulence screens: Compounds can be screened for their ability to reduce gelatinase production (a downstream effect of Fsr system activation) using agar plates containing gelatin or casein. Inhibition zones around compound-containing wells indicate potential FsrB inhibition.

Ex vivo tissue models: More advanced screening could utilize ex vivo tissue models (such as corneal or endocardial tissue) to assess whether potential inhibitors reduce E. faecalis virulence in a more physiologically relevant context.

These complementary screening approaches can identify compounds that specifically target FsrB functions, potentially leading to novel anti-virulence therapeutics for treating E. faecalis infections.

What are the current gaps in FsrB research and promising future directions?

Despite significant advances in understanding FsrB's role in E. faecalis quorum sensing, several knowledge gaps remain that represent promising areas for future research:

Structural characterization: While FsrB's secondary structure has been partially characterized as predominantly α-helical, high-resolution structural data (X-ray crystallography or cryo-EM) is lacking . Determining FsrB's three-dimensional structure would significantly advance understanding of its mechanism and facilitate structure-based drug design.

Mechanistic insights into dual functionality: The precise mechanism by which FsrB both processes FsrD and potentially transports GBAP remains incompletely understood . Detailed biochemical studies using site-directed mutagenesis could help map functional domains responsible for each activity.

FsrB-FsrD interaction dynamics: The molecular details of how FsrB recognizes and cleaves the FsrD propeptide need further elucidation. Identifying the specific residues involved in this interaction could provide targets for inhibitor design.

GBAP binding site characterization: While GBAP binding to FsrB has been demonstrated, the precise binding site and binding mode remain unknown . Photoaffinity labeling or hydrogen-deuterium exchange mass spectrometry could map this interaction site.

FsrB regulation: The factors controlling fsrB expression beyond the Fsr system itself require further investigation. Understanding how environmental signals modulate FsrB levels could reveal additional intervention points.

Host-pathogen interactions: How host factors interact with or influence FsrB function during infection remains largely unexplored. Studies in relevant host environments could reveal how FsrB activity is modulated during pathogenesis.

Clinical isolate variation: Analyzing fsrB sequence and expression variations among clinical isolates could provide insights into evolutionary adaptations and potentially explain virulence differences between strains.

Interspecies communication: Investigating whether FsrB or GBAP interact with signaling systems of other bacterial species in polymicrobial communities could reveal new dimensions of quorum sensing in complex infections.

Nanotechnology-based targeted delivery: Developing nanoparticle-based delivery systems for FsrB inhibitors could improve their efficacy and specificity while minimizing side effects on beneficial microbiota.

These research directions collectively have the potential to advance our understanding of FsrB's role in E. faecalis pathogenicity and open new avenues for therapeutic intervention against this increasingly important nosocomial pathogen.