Recombinant Escherichia coli Flagellar protein FliL (fliL)

What is the molecular structure and function of FliL in bacterial flagella?

FliL is a bacterial flagellar protein demonstrated to associate with and regulate ion flow through the stator complex in diverse bacterial species. The protein plays a crucial stabilizing role in flagellar motor function, particularly by forming interactions with the MotAB stator complex that are critical under high viscous drag conditions.
In E. coli, FliL is part of the fliL operon containing seven genes involved in flagellar biosynthesis and function. Structural analysis reveals FliL is a highly hydrophobic protein with a periplasmic domain that exhibits a fold similar to the stomatin/prohibitin/flotillin/HflK/C (SPFH) domain, which functions with acid-sensing ion channels .
Functional characterization across species indicates that FliL:

• Modulates proton flow via the stator plug

• Maintains structural integrity of the flagellar motor

• Forms circumferentially positioned rings required for stator activation

• Acts as a scaffold protein, particularly important during motility in viscous environments

How does the essentiality of FliL vary across bacterial species?

The requirement for FliL in bacterial motility shows significant species-dependent variation:

What is the genetic organization of the fliL operon in E. coli?

The fliL operon of Escherichia coli contains seven genes involved in flagellar biosynthesis and function. A 2.2-kb PstI restriction fragment has been shown to complement known mutant alleles of the fliO, fliP, fliQ, and fliR genes, which represent the four remaining genes of the fliL operon .
DNA sequence analysis identified four open reading frames that encode highly hydrophobic polypeptides with the following characteristics:

How does FliL interact with other flagellar proteins?

FliL forms specific protein-protein interactions crucial for flagellar function:

• Self-interaction: Pulldown and yeast two-hybrid assays demonstrate that the periplasmic domain of FliL interacts with itself, suggesting possible oligomerization important for its scaffold function .

• MotB interaction: While direct interaction between FliL and the periplasmic domain of MotB has not been observed in pulldown assays, FliL likely participates in the coupling of MotB with the flagellar rotor in an indirect fashion .

• Stator complex: Evidence indicates FliL regulates the MotAB stator complex by contacting the MotB plug region to control proton flow. Suppressor mutations in ΔfliL strains often map to this region of MotB .

• Circumferential positioning: Cryo-electron tomography (cryo-ET) studies in H. pylori revealed FliL forms a scaffold of circumferentially positioned rings required for stator activation .
  These interactions are particularly important under high-load conditions such as swimming in viscous media or swarming on surfaces.

What expression systems and vectors are optimal for recombinant FliL production in E. coli?

For recombinant FliL expression in E. coli, researchers should consider several expression systems based on protein properties and experimental needs:
Recommended expression vectors for FliL:

• pET Expression System:

  • Provides tight control of gene expression through T7 promoter

  • Suitable for potentially toxic proteins like FliL

  • Example: pET28α(+) with N-terminal His-tag for purification

• FLAG Expression System:

  • Enables fusion of FLAG peptide for detection and affinity purification

  • Available in both N-terminal and C-terminal fusion configurations

  • Suitable for isolation of biologically active proteins using mild conditions

• ELP Fusion System for Low Expression:

  • For ultra-low expression levels (<100 μg/L culture)

  • Utilizes elastin-like polypeptides (ELPs) that undergo reversible phase transition

  • Enables purification through inverse transition cycling (ITC)
    Optimization parameters for FliL expression:

• Strain selection: BL21(DE3) recommended for membrane proteins

• Induction: 0.1-1.0 mM IPTG when culture reaches OD600 ~0.6

• Temperature: Lower temperatures (16-25°C) may enhance solubility

• Media: Rich media (2× YT) supplemented with appropriate antibiotics
  For FliL specifically, incorporating a solubility tag like MBP (maltose-binding protein) is advisable due to the hydrophobic nature of the protein .

What purification strategies are effective for isolating recombinant FliL from E. coli?

Due to FliL's hydrophobic nature, purification requires specialized approaches:
Two-stage purification protocol for recombinant FliL:

• Initial capture:

  • Affinity chromatography using His6-tag (Ni-NTA resin)

  • Buffer conditions: 50 mM Tris-HCl pH 8.0, 300 mM NaCl, 0.1% DDM

  • Elution with imidazole gradient (20-250 mM)

• Polishing step:

  • Size exclusion chromatography (Superdex 200)

  • Buffer: 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% DDM
    For inclusion body recovery (when FliL forms aggregates):

• Solubilize using mild conditions (4M urea) to preserve native-like structures

• Perform pulsatile dilution for proper refolding

• Purify by ion-exchange followed by gel filtration chromatography
  This mild solubilization technique can retain native-like structures and improve recovery of bioactive protein. The approach has shown ~50% recovery of bioactive protein from inclusion bodies in other challenging bacterial proteins .

What experimental approaches can be used to study FliL's structural characteristics?

Several complementary techniques provide insights into FliL structure:

• X-ray Crystallography:

  • Most effective for the C-terminal periplasmic domain after expression and purification

  • Multiple crystal forms should be analyzed to confirm structural features

  • Has revealed a fold similar to SPFH domains in other species

• Cryo-Electron Tomography (cryo-ET):

  • Visualizes FliL in intact flagellar motors in situ

  • Allows localization within the native motor complex

  • Has revealed FliL forms circumferentially positioned rings in H. pylori

• Secondary Structure Analysis:

  • Circular dichroism (CD) spectroscopy to analyze α-helical and β-sheet content

  • Thermal denaturation studies to determine melting temperature (Tm)

  • Sizing methods (SEC-MALS) to determine oligomerization state

• Computational Approaches:

  • Molecular dynamics simulations to model membrane interactions

  • Homology modeling based on related SPFH-domain proteins

  • Prediction of transmembrane regions and topology
    These structural investigations are essential for understanding the mechanism of FliL function in flagellar motility.

How can researchers visualize FliL localization and dynamics in vivo?

Visualizing FliL localization requires specialized microscopy techniques:

• GFP-FliL Fusion Constructs:

  • Enables direct visualization of FliL within living cells

  • In R. sphaeroides, GFP-FliL forms both polar and lateral fluorescent foci with different spatial dynamics

  • Expression must be carefully controlled as overexpression can disrupt normal localization

• Fluorescence Microscopy Techniques:

  • Confocal microscopy for 3D localization

  • Total internal reflection fluorescence (TIRF) microscopy for membrane-proximal visualization

  • Fluorescence recovery after photobleaching (FRAP) to study dynamics

• Super-Resolution Microscopy:

  • Stimulated emission depletion (STED) microscopy

  • Photoactivated localization microscopy (PALM)

  • Stochastic optical reconstruction microscopy (STORM)

  • These techniques overcome the diffraction limit to resolve nanoscale structures

• Correlative Light and Electron Microscopy (CLEM):

  • Combines fluorescence and electron microscopy

  • Allows correlation of FliL-GFP signals with ultrastructural features
    When designing GFP-FliL fusion proteins, the placement of the GFP tag (N-terminal vs. C-terminal) should be optimized to minimize disruption of FliL function and localization.

How do mutations in FliL affect flagellar motor function across different bacterial species?

Mutational analysis has provided significant insights into FliL function:

What methodological approaches can be used to study FliL's role in flagellar motility under varying viscosity conditions?

FliL's function is particularly important in viscous environments, requiring specialized experimental approaches:

• Swimming Assays in Variable Viscosity Media:

  • Methylcellulose or Ficoll at concentrations from 0-30% to increase viscosity

  • Video microscopy tracking of swimming speeds and patterns

  • Comparison between wild-type and ΔfliL mutants at each viscosity level

• Microfluidic Devices:

  • Create controlled viscosity gradients

  • Monitor bacterial adaptation to changing conditions

  • Allow single-cell tracking of motility parameters

• Direct Motor Measurements:

  • Tethered cell assays with high-speed video recording

  • Single motor bead assays to measure rotation speeds and torque

  • Resurrection experiments to correlate stator unit function with FliL

• Swarming Assays:

  • Surface motility on agar plates of varying concentrations (0.3-1.5%)

  • Quantification of swarming diameter and microscopic swarm patterns

  • Particularly relevant as fliL mutants show greater defects under swarming conditions

• Experimental Design Considerations:

  • Control for growth rate differences between strains

  • Standardize inoculation methods

  • Include multiple time points for temporal analysis

  • Use complementation assays to confirm phenotypes are due to fliL mutation
    H. pylori serves as an excellent model organism for these studies due to its naturally high motility in viscous media and clear dependence on FliL for motility .

How can researchers assess the immunological properties of recombinant FliL compared to other flagellar proteins?

While bacterial flagellin (FliC) is well-characterized as an immunostimulatory molecule, less is known about FliL's immunological properties. Researchers can employ the following approaches:

• In Vitro Immune Cell Stimulation:

  • Culture human/mouse cells (e.g., Caco-2, THP-1) with purified recombinant FliL

  • Measure cytokine production (IL-8, TNF-α) via ELISA or qRT-PCR

  • Compare responses to known TLR5 agonists like FliC

• Receptor Binding Studies:

  • Assess FliL binding to pattern recognition receptors

  • Compare with FliC binding to TLR5, which has been well-characterized

  • Use surface plasmon resonance (SPR) or microscale thermophoresis

• Adjuvant Potential Assessment:

  • Co-administration of FliL with model antigens in mice

  • Measurement of antigen-specific antibody responses

  • Comparison with established flagellin-based adjuvants

• qRT-PCR Analysis of Immune Response Genes:
  Utilize primer sets similar to those used for FliC studies :

  Gene	Forward Primer (5'-3')	Reverse Primer (5'-3')
  GAPDH	GCCTTCCGTGTTCCTACCC	TGCCTGCTTCACCACCTTC
  IL-4	ACAGGAGAAGGGACGCCAT	GAAGCCCTACAGACGAGCTCA
  IFNγ	TCAAGTGGCATAGATGTGGAAGAA	TGGCTCTGCAGGATTTTCATG
  TNF	AGCCCCCAGTCTGTATCCTT	CTCCCTTTGCAGAACTCAGG

• Cross-Reactivity Analysis:

  • Assess whether anti-FliC antibodies recognize FliL epitopes

  • Determine whether FliL stimulates similar signaling pathways as FliC

  • Evaluate species cross-reactivity of immune responses to FliL
    These approaches will help determine whether FliL has immunomodulatory properties distinct from the well-characterized flagellin (FliC) adjuvant effects .

Title: Recombinant Escherichia coli Flagellar Protein FliL (fliL): Frequently Asked Questions for Researchers

This comprehensive collection of frequently asked questions addresses key research considerations about recombinant Escherichia coli flagellar protein FliL. Organized by complexity level, this resource provides methodological approaches for both fundamental research and advanced experimental techniques.

What is the molecular structure and function of FliL in bacterial flagella?

FliL is a bacterial flagellar protein that associates with and regulates ion flow through the stator complex in diverse bacterial species. This highly hydrophobic membrane protein plays a critical role in flagellar motor function, particularly by forming interactions with the MotAB stator that become essential under high viscous drag conditions .
Structural analysis reveals that FliL contains a periplasmic domain with a fold similar to the stomatin/prohibitin/flotillin/HflK/C (SPFH) domain of proteins that function with ion channels. In Helicobacter pylori, cryo-electron tomography has shown that FliL forms a scaffold of circumferentially positioned rings required for stator activation .
Functional studies indicate that FliL:

• Modulates proton flow through the stator by interacting with the MotB plug region

• Maintains structural integrity of the flagellar motor

• Facilitates motor rotation under high-load conditions

• Acts as a scaffold protein, particularly important for motility in viscous environments

Which bacterial species require FliL for motility?

The requirement for FliL in bacterial motility shows significant species-dependent variation:

What is the structure of the fliL operon in E. coli?

The fliL operon of Escherichia coli contains seven genes involved in flagellar biosynthesis and function. A 2.2-kb PstI restriction fragment has been shown to complement known mutant alleles of the fliO, fliP, fliQ, and fliR genes, which represent four of the seven genes in this operon .
DNA sequence analysis identified four open reading frames that encode highly hydrophobic polypeptides with the following molecular characteristics:

How does FliL interact with other flagellar proteins?

FliL establishes specific protein interactions crucial for flagellar function:

• Self-interaction: Pulldown and yeast two-hybrid assays demonstrate that the periplasmic domain of FliL interacts with itself, suggesting possible oligomerization important for its scaffold function .

• MotB interaction: While direct interaction between FliL and the periplasmic domain of MotB has not been observed in pulldown assays, FliL likely participates in the coupling of MotB with the flagellar rotor in an indirect fashion .

• Stator complex regulation: Evidence indicates FliL modulates the MotAB stator complex by interacting with the MotB plug region to control proton flow. Suppressor mutations in ΔfliL strains often map to this region of MotB .
  In Rhodobacter sphaeroides, eight independent pseudorevertants isolated from a fliL mutant strain each contained a single nucleotide change in motB affecting only three residues located on the periplasmic side of MotB, strongly suggesting functional interaction between these proteins .

What expression systems and vectors are optimal for recombinant FliL production in E. coli?

For effective recombinant FliL expression, several systems should be considered:
Expression vector selection:

• pET28α(+) vector system provides tight control through the T7 promoter and IPTG induction

• FLAG expression vectors enable detection and purification through FLAG epitope fusion

• For difficult-to-express proteins, elastin-like polypeptide (ELP) fusion vectors allow purification via inverse transition cycling
  Optimized protocol for FliL expression:

• Transform expression construct into E. coli BL21(DE3)

• Grow bacterial culture in 2× YT medium with appropriate antibiotics at 37°C

• Induce expression with 1 mM IPTG when OD600 reaches ~0.6

• Continue expression for 4 hours (or overnight at lower temperatures)

• Harvest cells by centrifugation and process for protein extraction
  Given FliL's hydrophobic nature, fusion to a solubility-enhancing partner like maltose-binding protein (MBP) is recommended to improve soluble expression .

What are the challenges in producing soluble recombinant FliL and how can they be addressed?

Producing soluble recombinant FliL presents several challenges due to its highly hydrophobic nature. Researchers can address these challenges through various strategies:

• Fusion protein approach:

  • Fusion with maltose-binding protein (MBP), which serves as a highly effective solubilizing agent

  • Construction of dual His6-MBP tagged fusion proteins via Gateway® recombinational cloning

  • Inclusion of a TEV protease cleavage site for tag removal after solubilization

• Inclusion body recovery:

  • Mild solubilization with low urea concentrations (2-4M) preserves native-like protein structures

  • Pulsatile dilution method for refolding improves recovery of bioactive protein

  • Purification via ion-exchange followed by gel filtration chromatography

• For ultra-low expression:

  • Elastin-like polypeptide (ELP) co-aggregation technique

  • Addition of excess free ELP to cell lysate drives phase transition at low concentrations

  • Capable of purifying proteins expressed at levels approaching a single protein molecule per cell
    This approach has been successful with other challenging membrane proteins, with recovery rates of ~50% bioactive protein from inclusion bodies .

What experimental approaches can be used to study FliL's role in flagellar function?

Multiple experimental approaches provide insights into FliL function:

• Genetic manipulation:

  • Construction of fliL deletion mutants via homologous recombination

  • Complementation studies with wild-type or mutated fliL genes

  • Isolation and characterization of suppressor mutations (particularly in motB)

• Structural characterization:

  • Cryo-electron tomography (cryo-ET) to visualize FliL within intact flagellar motors

  • X-ray crystallography of the C-terminal periplasmic domain

  • Computational modeling of membrane integration

• Protein localization:

  • GFP-FliL fusion proteins reveal localization patterns

  • Fluorescence microscopy to track spatial dynamics

  • Immunogold labeling with electron microscopy

• Functional assays:

  • Swimming motility assays in liquid media

  • Swarming assays on semi-solid agar

  • Single-cell tracking and flagellar rotation measurements

  • Behavior in media of increasing viscosity
    These complementary approaches allow researchers to comprehensively characterize the structural and functional properties of FliL in flagellar motility.

What techniques can be used to visualize FliL localization in vivo?

Visualizing FliL localization requires specialized approaches:

• GFP-FliL fusion constructs:

  • In Rhodobacter sphaeroides, GFP-FliL forms polar and lateral fluorescent foci with different spatial dynamics

  • Localization depends on expression of flagellar genes controlled by the master regulator FleQ

  • Proper expression level control is essential for authentic localization patterns

• Advanced microscopy techniques:

  • Fluorescence microscopy for basic localization

  • Confocal microscopy for 3D visualization

  • Total internal reflection fluorescence (TIRF) microscopy for membrane-proximal visualization

  • Super-resolution microscopy for nanoscale structural details

• Immunofluorescence approaches:

  • Generation of specific anti-FliL antibodies

  • Fixation and permeabilization protocols optimized for membrane proteins

  • Co-localization studies with other flagellar components
    When designing GFP fusion constructs, researchers should test both N-terminal and C-terminal fusions, as the position of the tag may affect protein function and localization.

How do mutations in FliL affect flagellar motor function?

Mutational analysis reveals species-specific effects of FliL disruption:

What is the relationship between FliL and flagellar motility in viscous media?

FliL's function becomes particularly critical under high viscous drag conditions:

• Experimental evidence:

  • FliL mutants have greater motility defects under swarming conditions compared to swimming

  • H. pylori, which naturally resides in highly viscous mucus, shows high FliL dependence

  • Under high viscosity, flagellar motor experiences increased torque requirements

• Mechanistic hypothesis:

  • FliL may stabilize the stator-rotor interaction under mechanical stress

  • It could act as a scaffold that maintains proper positioning of stator units

  • May be involved in mechanosensing to optimize motor function in different environments

• Experimental approach for viscosity studies:

  • Compare motility of wild-type and ΔfliL strains in media with increasing viscosity

  • Use methylcellulose or Ficoll at varying concentrations (0-30%)

  • Measure swimming speed, directional changes, and flagellar rotation rates

  • Analyze swarming behavior on agar surfaces of different concentrations
    These studies suggest that FliL helps maintain structural integrity of the flagellar motor under conditions requiring higher torque generation .

How can researchers design experiments to analyze the interaction between FliL and the stator complex?

To investigate FliL-stator interactions, researchers can employ several complementary approaches:

• Protein-protein interaction assays:

  • Bacterial two-hybrid system using FliL and MotB domains

  • Co-immunoprecipitation with tagged proteins

  • Surface plasmon resonance (SPR) with purified components

  • FRET analysis using fluorescently labeled proteins

• Mutational analysis:

  • Site-directed mutagenesis targeting conserved residues in FliL

  • Identification of suppressor mutations in MotB that restore function in ΔfliL strains

  • Construction of chimeric proteins between species with different FliL requirements

• Structural studies:

  • Cryo-electron tomography of intact motors

  • X-ray crystallography of interacting domains

  • Cross-linking followed by mass spectrometry to identify interaction interfaces

• Functional assays:

  • Measure proton flux through stator complexes in the presence/absence of FliL

  • Analyze stator assembly and turnover rates

  • Monitor flagellar rotation parameters (speed, direction switches, torque generation)
    When designing these experiments, researchers should consider:

• Using multiple bacterial species to identify conserved interaction mechanisms

• Controlling for protein expression levels

• Including complementation controls

• Employing both in vivo and in vitro approaches for validation These approaches will help elucidate the molecular basis of FliL's role in stator function and activation, particularly under high-load conditions.