Recombinant Eumops perotis Cytochrome b (MT-CYB) is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex) within the mitochondrial respiratory chain. This complex facilitates electron transfer from ubiquinol to cytochrome c, contributing to the generation of a proton gradient across the mitochondrial membrane. This gradient is subsequently utilized for ATP synthesis.
Cytochrome b is a mitochondrial DNA-encoded protein that functions as a critical component of the electron transport chain's complex III. In Eumops perotis (greater mastiff bat), this gene has particular significance for several research applications:
Taxonomic resolution: MT-CYB serves as a valuable marker for species identification and phylogenetic studies in bats due to its appropriate mutation rate and conserved regions .
Evolutionary studies: The gene provides insights into the evolutionary relationships among bat species, particularly within the family Molossidae to which Eumops perotis belongs .
Functional research: As part of the respiratory chain, MT-CYB's structure and mutations can reveal adaptations specific to the high-energy flight requirements of these large bats.
Eumops perotis is a particularly interesting species as it is one of the largest bats in North America with distinctive morphological features, making its molecular characteristics valuable for comparative studies .
For optimal extraction of mitochondrial DNA containing the MT-CYB gene from Eumops perotis:
Tissue selection: Wing membrane biopsies (3-5 mm diameter) are preferred for non-lethal sampling. Alternatively, liver or muscle tissue can be used from preserved specimens.
Preservation method: Immediately place fresh tissue in 95% ethanol or RNA-later solution and store at -20°C for short-term or -80°C for long-term preservation.
Extraction protocol:
Commercial kits (e.g., QIAGEN DNeasy Blood & Tissue Kit) modified for highly fibrous bat wing membranes
For museum specimens, specialized ancient DNA protocols may be required
Include additional purification steps to remove PCR inhibitors common in bat tissues
PCR amplification of the full MT-CYB gene (approximately 1140 bp) may require multiple overlapping primer sets
Tissue collection should adhere to ethical guidelines for bat research, especially given the protected status of many bat populations .
Based on research using cytochrome b for bat species identification, the following primer combinations have proven effective:
| Primer Pair | Sequence (5' to 3') | Target Region | Fragment Size (bp) | Annealing Temp (°C) |
|---|---|---|---|---|
| Bat-CytB-F1 | CATAGCCAACGCACTAATCAC | 5' region | ~450 | 55 |
| Bat-CytB-R1 | GTCTTGTAAACCGGAGCTAGG | 5' region | ~450 | 55 |
| Bat-CytB-F2 | CTACGGCTCATACCTCAAAG | Middle region | ~400 | 54 |
| Bat-CytB-R2 | CTCCTAGTTTATTAGGACTCCTG | Middle region | ~400 | 54 |
| Bat-CytB-F3 | GAGGACAAATATCATTCTGAGG | 3' region | ~450 | 56 |
| Bat-CytB-R3 | TAGGCRAATAGGAARTATCATTC | 3' region | ~450 | 56 |
For heterologous expression systems, modified primers with appropriate restriction sites and kozak sequences should be designed based on the complete sequence .
Expressing functional mitochondrial proteins like cytochrome b in bacterial systems presents several challenges that require optimization:
Codon optimization: Mitochondrial genetic code differs from bacterial code; therefore, sequence modification is essential:
ATA (isoleucine in standard code) codes for methionine in mitochondria
TGA (stop codon in standard code) codes for tryptophan in mitochondria
Membrane protein expression strategies:
Use of specialized E. coli strains (e.g., C41(DE3), C43(DE3)) designed for membrane proteins
Fusion with solubility tags (MBP, SUMO, Thioredoxin)
Lower induction temperatures (16-18°C) to reduce inclusion body formation
Heme incorporation:
Supplement media with δ-aminolevulinic acid (50-100 μg/ml)
Co-express with cytochrome c heme lyase to facilitate proper heme attachment
Purification considerations:
Use mild detergents (DDM, LMNG) for membrane extraction
Implement two-step chromatography (affinity followed by size exclusion)
When designing constructs, note the topology of cytochrome b with its eight transmembrane helices, which makes expression challenging compared to soluble proteins .
Distinguishing functional from neutral mutations in MT-CYB requires multiple analytical approaches:
Sequence conservation analysis:
Compare across diverse bat species to identify highly conserved residues likely critical for function
Mutations in conserved regions (particularly in heme-binding domains) are more likely to affect function
Focus on cysteine residues that are often critical for structure and function, as seen in the m.14864 T>C mutation described in human MT-CYB that changes a conserved cysteine to arginine
Structural mapping:
Map mutations onto predicted 3D structures using homology modeling
Evaluate proximity to functional sites (heme binding, quinone binding, transmembrane regions)
Functional assays:
Electron transfer activity measurements using recombinant proteins
Respiratory chain complex III activity assays
Membrane potential measurements in mitochondrial or bacterial systems
Statistical tests for selection pressure:
dN/dS ratios to assess negative or positive selection
McDonald-Kreitman test to compare fixed differences between species versus polymorphisms
Example analysis approach: Conservative amino acid substitutions in variable regions of the protein are more likely to represent taxonomic variation, while non-conservative changes in conserved regions (particularly at positions 40, 158, and 271) may impact function .
When MT-CYB gene sequences produce phylogenies that conflict with other molecular markers or morphological data:
Evaluate potential sources of error:
Nuclear mitochondrial DNA segments (NUMTs) contamination
Introgression or hybridization events
Heteroplasmy in mitochondrial DNA
Long-branch attraction artifacts
Multi-gene approach:
Combine MT-CYB with other mitochondrial genes (COI, 16S rRNA)
Include nuclear markers (RAG2, BRCA1) for comparative analyses
Construct species trees rather than gene trees using methods like *BEAST
Advanced phylogenetic methods:
Partition data by codon position
Apply mixed models of sequence evolution
Use Bayesian approaches with appropriate priors based on bat evolutionary rates
Implement coalescent-based species tree estimation
Taxonomic sampling considerations:
Heterogeneous taxonomic resolution has been observed in bat cytochrome b studies, suggesting that this marker alone may not fully resolve all taxonomic relationships, particularly among closely related species .
Comparing the structural features of Eumops perotis MT-CYB with other mammals reveals important evolutionary adaptations:
Primary structure comparison:
Eumops perotis MT-CYB contains approximately 380 amino acids, similar to other mammals
Key differences are observed in regions associated with thermostability and energy efficiency
Several bat-specific amino acid substitutions appear to correlate with high-energy flight requirements
Structural motifs:
Molecular modeling analysis:
Homology models based on bovine or porcine cytochrome b crystal structures reveal subtle differences in the positioning of functional domains
Loop regions connecting transmembrane helices show greater variability among species
Potential adaptations in the proton translocation pathway may correlate with metabolic requirements
| Feature | Eumops perotis | Other Bats | Non-flying Mammals |
|---|---|---|---|
| Transmembrane helices | 8 | 8 | 8 |
| Heme binding sites | 2 | 2 | 2 |
| Quinone binding sites | Modified Q₀ site | Similar modifications in high-flight bats | Standard configuration |
| Loop region length | Shortened | Variable | Generally longer |
| Thermostability motifs | Enhanced | Enhanced in migratory species | Standard |
These structural differences may reflect adaptations to the high metabolic demands of flight and the ecological niche occupied by Eumops perotis .
Post-translational modifications (PTMs) significantly impact the functionality of recombinant MT-CYB and must be considered when designing expression systems:
Critical PTMs for cytochrome b function:
Heme incorporation: Two heme B groups must be properly incorporated into the protein
Membrane insertion: Proper folding requires coordinated insertion into the lipid bilayer
Interaction with iron-sulfur protein and cytochrome c₁: Assembly into functional complex III
Challenges in recombinant systems:
Bacterial systems lack mitochondrial membrane insertion machinery
Eukaryotic systems may introduce non-native PTMs
Heme incorporation may be inefficient in heterologous systems
Detection methods for PTMs:
Absorption spectroscopy to confirm heme incorporation (peaks at ~562 nm and ~530 nm)
Mass spectrometry to identify other modifications
Functional assays to assess electron transfer capacity
Optimization strategies:
Co-expression with bat-specific assembly factors
Modified membrane-mimetic systems (nanodiscs, liposomes)
Directed evolution approaches to enhance folding and stability
For functional studies, maintaining native-like membrane environments is crucial, as complex III activity depends on proper lipid interactions and supramolecular assembly .
Recombinant MT-CYB offers several approaches to investigate metabolic adaptations in bats:
Comparative functional analysis:
Measure electron transfer rates of recombinant MT-CYB from Eumops perotis versus other mammals
Assess efficiency under varying temperature conditions to understand thermal adaptations
Compare oxygen affinity and ROS production between bat and non-bat cytochrome b
Directed mutagenesis studies:
Generate chimeric proteins with domains from different species
Introduce bat-specific amino acid substitutions into non-bat cytochrome b
Revert bat-specific substitutions to ancestral states to assess functional impact
Metabolic flux analysis:
Incorporate recombinant bat proteins into membrane systems to measure respiratory chain kinetics
Assess influence on proton translocation efficiency
Compare energy coupling under conditions simulating flight metabolism
Structural adaptations:
Analyze protein stability under varying temperatures and pH conditions
Assess structural flexibility through hydrogen-deuterium exchange experiments
Evaluate resistance to oxidative stress compared to non-flying mammals
The large body size of Eumops perotis (157-184 mm total length) combined with its specialized flight adaptations makes it an excellent model for understanding metabolic efficiency in flying mammals .
When using MT-CYB for molecular dating and divergence time estimation:
Calibration strategies:
Use fossil records of Molossidae family bats as primary calibration points
Apply secondary calibrations from comprehensive mammalian phylogenies
Implement cross-validation of multiple calibration points
Substitution rate considerations:
Account for lineage-specific rate variation in bats
Apply relaxed clock models (uncorrelated lognormal or exponential) rather than strict clocks
Partition data by codon position with separate substitution models
Analytical approaches:
Bayesian methods (BEAST, MrBayes) with appropriate priors on node ages
Maximum likelihood with penalized likelihood rate smoothing
Total Evidence Dating incorporating morphological and molecular data
Validation methods:
Compare results using different calibration schemes
Assess sensitivity to prior distributions
Cross-validate with independent molecular markers
| Node | Fossil Evidence | Estimated Age (MYA) | Reference |
|---|---|---|---|
| Crown Molossidae | Earliest molossid fossils | 37-40 | Paleontological record |
| Eumops genus | First Eumops fossils | 15-20 | Molecular studies |
| Eumops perotis clade | Divergence from sister species | 5-7 | Phylogenetic analyses |
When analyzing the tempo of evolution in different species of Eumops, the heterogeneous taxonomic resolution of MT-CYB must be considered, as evolutionary rates may vary across the genus .