Recombinant Gambusia affinis Rhodopsin (rho)

What is Recombinant Gambusia affinis Rhodopsin (rho)?

Recombinant Gambusia affinis Rhodopsin (rho) is a light-sensitive G protein-coupled receptor protein derived from the Western mosquitofish (Gambusia affinis). The protein is produced through recombinant DNA technology to replicate the naturally occurring rhodopsin found in the photoreceptor cells of the fish retina. The full-length protein consists of 354 amino acids and is identified in the UniProt database under accession number P79756 . This recombinant protein serves as a valuable tool for studying visual transduction mechanisms, G protein-coupled receptor signaling, and comparative visual physiology across species.

How should Recombinant Gambusia affinis Rhodopsin be stored and handled for optimal research results?

For optimal stability and experimental reproducibility:

Storage Conditions:

• Store at -20°C for regular use or -80°C for long-term storage

• Maintain in Tris-based buffer with 50% glycerol as specified for this protein

• Protect from light exposure due to the photosensitive nature of the protein

Handling Recommendations:

• Avoid repeated freeze-thaw cycles; create working aliquots

• Working aliquots may be stored at 4°C for up to one week

• Handle under dim red light conditions when conducting light-sensitive experiments

• Maintain proper pH (typically 6.5-7.5) for stability

• For extended storage, use -20°C or -80°C as recommended in product specifications

How does Gambusia affinis Rhodopsin compare to rhodopsin from other fish species?

Comparative analysis of Gambusia affinis Rhodopsin with other fish species reveals several important differences and similarities:

Sequence Conservation:

• High conservation in transmembrane domains and retinal binding pocket

• Greater variability in N- and C-terminal regions

• Sequence analysis places Gambusia rhodopsin closer to other members of Poeciliidae family

Evolutionary Relationship:

• Estimated divergence from sister species G. holbrooki approximately 1.5-4.7% at the DNA sequence level

• Cytochrome b gene shows 4.68% sequence difference between G. affinis and G. holbrooki

• Control region shows 1.52% sequence difference between the species

Functional Adaptation:

• As a shallow-water species, Gambusia affinis likely has rhodopsin tuned to specific wavelength sensitivity

• Environmental adaptation has shaped the protein's thermal stability and spectral characteristics

What expression systems are most effective for producing functional Recombinant Gambusia affinis Rhodopsin?

Several expression systems can be employed, each with specific advantages for different research applications:

Purification typically involves affinity chromatography using tags determined during the production process , followed by size exclusion chromatography to achieve high purity. The expression region for full-length protein spans amino acids 1-354 .

What are the optimal conditions for functional assays using Recombinant Gambusia affinis Rhodopsin?

Functional assays for rhodopsin typically measure G protein activation, arrestin binding, or conformational changes:

G Protein Activation Assay:

• Buffer composition: 20 mM HEPES (pH 7.4), 100 mM NaCl, 5 mM MgCl₂, 2 mM DTT

• Temperature: 25°C (physiologically relevant for Gambusia)

• Rhodopsin concentration: 10-50 nM

• G protein concentration: 100-500 nM

• Dark adaptation: Minimum 1 hour before assay

Absorption Spectroscopy:

• Buffer: 100 mM phosphate (pH 7.0), 0.1% detergent

• Temperature control: ±0.1°C for thermal stability measurements

• Scan parameters: 250-650 nm, 1 nm intervals

• Expected absorbance maximum: ~500 nm (typical for fish rhodopsins)

Common Pitfalls to Avoid:

• Uncontrolled light exposure (use red filters >630 nm)

• Buffer components that interfere with assays

• Protein aggregation (maintain appropriate detergent concentrations)

• Signal saturation (optimize protein concentrations through preliminary experiments)

How can researchers verify the species identity when working with Gambusia affinis?

To ensure experimental validity when working with Gambusia affinis rhodopsin, species verification is essential:

PCR-Based Verification:

• Design species-specific cytochrome oxidase subunit 1 (COI) primers

• Example primers for G. affinis identification:

  • COI_GafF: TAATTGGTGCCCCCGACATG

  • COI_GafR: GGAGGACAGCTGTAATTAGGACTGCTCAC

• PCR conditions: 15 min at 95°C, followed by 32 cycles of 30s at 94°C, 30s at 66°C, and 45s at 72°C

• These primers amplify a 327bp product at 66°C in G. affinis but not in the closely related G. holbrooki

Sequence Verification:

• Sequence the amplified COI fragment

• Compare with reference sequences in GenBank

• For additional confirmation, analyze mitochondrial control region and cytochrome b gene sequences

How can Recombinant Gambusia affinis Rhodopsin be used in light-response studies?

Recombinant Gambusia affinis Rhodopsin provides a valuable model for photobiological research:

Spectral Sensitivity Measurements:

• UV-Vis spectroscopy to determine wavelength of maximum absorption (λmax)

• Experimental setup: Measure absorbance between 250-650 nm before and after photobleaching

• Analysis: Calculate difference spectra and determine peak absorption

• Expected λmax: Approximately 500 nm (typical for fish rhodopsins)

Flash Photolysis for Conformational Kinetics:

• Technique: Time-resolved spectroscopy measuring formation and decay of photointermediates

• Key parameters to measure:

  • Meta I to Meta II transition rates

  • Schiff base deprotonation kinetics

  • Thermal decay back to ground state

• Equipment: Stopped-flow apparatus with millisecond time resolution

Reconstitution Systems:

• Liposome incorporation for near-native environment studies

• Protocol outline:

  • Prepare small unilamellar vesicles (SUVs)

  • Mix rhodopsin with SUVs at 1:100 protein:lipid ratio

  • Remove detergent via dialysis

  • Verify incorporation via sucrose density gradient

What structural modifications of Recombinant Gambusia affinis Rhodopsin have been studied?

Various structural modifications can be introduced to study structure-function relationships:

Site-Directed Mutagenesis Studies:

Chimeric Constructs:

• Replace specific transmembrane domains or loops between Gambusia rhodopsin and other species

• Map functional domains responsible for species-specific properties

• Measure differences in activation kinetics, spectral properties, or thermal stability

Post-Translational Modification Variants:

• Glycosylation site mutations (N2D, N15D)

• Palmitoylation site alterations (C322S, C323S)

• Phosphorylation site modifications in C-terminal region

How does environmental exposure to compounds affect Rhodopsin expression in Gambusia affinis?

Environmental compounds can modulate rhodopsin expression through various mechanisms:

Transcriptional Regulation Pathways:

• Nuclear receptors like PXR (Pregnane X Receptor) influence rhodopsin expression

• Research shows that compounds like diclofenac can alter PXR and downstream gene expression in Gambusia affinis

Experimental Approaches to Measure Effects:

• Gene Expression Analysis:

  • qRT-PCR analysis of rhodopsin mRNA levels

  • Use of reference genes: β-actin, GAPDH, or 18S rRNA for normalization

  • Exposure protocol: Typically 24-96 hour exposure to test compounds

• Protein Quantification:

  • Western blot using anti-rhodopsin antibodies

  • ELISA-based quantification

  • Normalize to total protein content

• Functional Impact Assessment:

  • ERG (electroretinogram) measurements after exposure

  • Behavioral assays (optomotor response, phototaxis)

Example Environmental Effects:

• Diclofenac at environmentally relevant concentrations (0.5-5 μg/L) can alter gene expression in G. affinis

• Studies on PXR and its downstream genes in G. affinis provide a model for understanding how environmental compounds might affect visual system genes

What techniques are most effective for studying Rhodopsin signaling pathways in Gambusia affinis?

Multiple complementary techniques can be used to study rhodopsin signaling:

In Vitro Biochemical Approaches:

• G-protein Activation Assays:

  • GTPγS binding assay measuring activation of transducin

  • Protocol outline:

    • Reconstitute rhodopsin with G-protein subunits

    • Add GTPγS

    • Measure binding kinetics with and without light

  • Expected results: Significant increase in binding rate after illumination

• Arrestin Recruitment Assays:

  • BRET (Bioluminescence Resonance Energy Transfer) based approach

  • Components:

    • Rhodopsin-luciferase fusion

    • Arrestin-fluorescent protein fusion

    • Measure energy transfer upon light activation

Cellular Approaches:

• Primary Cell Culture:

  • Isolation of photoreceptor cells from Gambusia retina

  • Calcium imaging to measure downstream signaling

  • Electrophysiological recording of light responses

• Heterologous Expression Systems:

  • HEK293 or COS-7 cells expressing Gambusia rhodopsin

  • Coupling to engineered signaling readouts

How can Recombinant Gambusia affinis Rhodopsin be used in comparative evolutionary studies?

Recombinant Gambusia affinis Rhodopsin serves as an excellent model for evolutionary studies:

Phylogenetic Analysis Approach:

• Sequence alignment of rhodopsin genes from multiple fish species

• Construction of phylogenetic trees using maximum likelihood or Bayesian methods

• Calculation of Ka/Ks ratios to identify sites under positive selection

• Use genetic markers like COI, control region, and cytochrome b for species differentiation

Experimental Validation Methods:

• Heterologous Expression of Rhodopsins from Related Species:

  • Compare functional properties across Poeciliidae family

  • Express in standardized cell systems

  • Measure spectral and kinetic parameters under identical conditions

• Site-Directed Mutagenesis to Test Adaptive Hypotheses:

  • Introduce specific mutations at sites predicted to be under selection

  • Measure spectral tuning changes using absorption spectroscopy

  • Quantify G-protein activation efficiency differences

Habitat Adaptation Correlations:

• Light environment vs. spectral tuning:

  • Compare rhodopsin properties between invasive G. affinis and native species

  • Measure visual performance metrics in varying light conditions

• Gambusia affinis vs. G. holbrooki comparison:

  • Study the molecular basis for the divergence between these sister species (1.52-4.68% sequence difference)

  • Correlate rhodopsin adaptations with habitat preferences in their natural and invasive ranges

What is known about the role of Rhodopsin in ecological adaptation of Gambusia affinis?

Gambusia affinis (Western mosquitofish) has successfully invaded diverse aquatic ecosystems worldwide:

Visual System Adaptation:

• As a visual predator, G. affinis relies on rhodopsin for foraging and predator avoidance

• Studies show G. affinis is used as a biocontrol agent for mosquito larvae

• Their visual system adaptability likely contributes to their success as invasive species

Environmental Plasticity:

• G. affinis can tolerate a wide range of environmental conditions

• The rhodopsin protein may show adaptive features that facilitate vision across varying water clarity and light conditions

• Their success in diverse habitats suggests visual system adaptability

Predation Efficiency:

• Research shows high predation efficiency (86.2%) against mosquito larvae

• This efficiency is maintained even in environments contaminated with certain anthropogenic compounds

• Visual system adaptability likely contributes to this ecological success

What are the challenges in crystallizing Recombinant Gambusia affinis Rhodopsin for structural studies?

Crystallizing rhodopsin proteins presents specific challenges due to their membrane protein nature:

Technical Challenges and Solutions:

• Protein Stability Issues:

  • Challenge: Rhodopsin is unstable when extracted from membranes

  • Solutions:

    • Use thermostabilizing mutations

    • Optimize detergent selection

    • Add lipids during purification

    • Maintain low temperature throughout purification

• Conformational Heterogeneity:

  • Challenge: Multiple conformational states complicate crystal formation

  • Solutions:

    • Lock protein in single state with stabilizing ligands

    • Use antibody fragments to stabilize conformation

    • Employ nanobody technology to reduce flexibility

Screening Strategy Approaches:

• Vapor diffusion with detergent screens (5-15 mg/mL protein concentration)

• Lipidic cubic phase crystallization (20-50 mg/mL protein concentration)

• Bicelle crystallization method (10-30 mg/mL protein concentration)

Alternative Structural Methods:

• Cryo-electron microscopy (resolution now reaching 2.5Å for membrane proteins)

• NMR for specific labeled domains

• Computational modeling based on homologous structures

What are emerging technologies for studying Recombinant Gambusia affinis Rhodopsin?

New methodological approaches are expanding research possibilities:

Advanced Imaging Techniques:

• Super-resolution microscopy to visualize rhodopsin distribution and dynamics

• Single-molecule FRET to measure conformational changes upon activation

• Cryo-EM for high-resolution structural determination without crystallization

Optogenetic Applications:

• Engineering G. affinis rhodopsin as an optogenetic tool for controlling cellular activity

• Chimeric constructs combining G. affinis rhodopsin with other proteins for specialized applications

• Potential applications in neuroscience and cell biology research

Computational Approaches:

• Molecular dynamics simulations to study conformational changes

• Machine learning for predicting rhodopsin-ligand interactions

• Systems biology approaches to model entire visual transduction pathways

High-Throughput Screening:

• Developing fluorescence-based assays for rapid screening of rhodopsin mutants

• Microfluidic platforms for parallel functional testing

• Automated imaging systems for quantifying cellular responses to rhodopsin activation