Recombinant Human 1-acyl-sn-glycerol-3-phosphate acyltransferase epsilon (AGPAT5)

What is the primary function of AGPAT5 in cellular metabolism?

AGPAT5 (1-Acylglycerol-3-Phosphate O-Acyltransferase 5) belongs to the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein catalyzes the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA) by incorporating an acyl moiety at the sn-2 position of the glycerol backbone, representing the second step in de novo phospholipid biosynthesis . The enzyme shows activity toward LPA containing saturated or unsaturated fatty acids C15:0-C20:4 at the sn-1 position using various acyl donors, with notable specificity for C18:1-CoA . AGPAT5 is associated with mitochondrial membranes and contributes to phospholipid homeostasis through its acyltransferase activity.

What is the spectrum of AGPAT5 substrate specificity?

AGPAT5 exhibits distinct substrate preferences that distinguish it from other AGPAT family members:

This pattern of substrate utilization indicates that AGPAT5 has evolved specific roles in phospholipid remodeling that extend beyond simple PA synthesis .

What are the most effective methods for expressing and purifying recombinant human AGPAT5?

For high-yield expression of enzymatically active AGPAT5, a recombinant adenoviral expression system has proven most effective. The recommended protocol includes:

• Vector Construction:

  • Amplify the full-length open reading frame of AGPAT5 (GenBank accession number NM_018361)

  • Add a V5-epitope tag at the amino-terminus using primers:

    • Forward: 5′-CCGCTCGAGATG GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG ACGCTGCTGTCCCTGGTGCTCCACACG-3′

    • Reverse: 5′-CCCAAGCTTCTATGCTTTAATAGTAACCC-3′

• Adenoviral Production:

  • Clone the amplified product into pShuttle-CMV vector at XhoI and HindIII restriction sites

  • Generate recombinant adenovirus by co-transforming pShuttle-CMV-AGPAT5 (digested with PmeI) with pAdEasy-1 into BJ5183 cells

  • Transfect the recombinant AdEasy-1-AGPAT5 plasmid (digested with PacI) into AD293 cells

  • Propagate and purify the virus using the Virabind adenovirus purification kit

• Expression:

  • Infect HEK-293 cells with AGPAT5 recombinant adenovirus at an MOI of 150 or higher

  • Harvest cells after 48 hours

• Cell Lysis and Protein Preparation:

  • Lyse cells in buffer (100 mM Tris pH 7.4, 10 mM NaCl containing protease inhibitor cocktail)

  • Use three freeze-thaw cycles followed by centrifugation at 3000g for 10 minutes at 4°C

  • This methodology has consistently yielded functionally active enzyme suitable for biochemical characterization

How can AGPAT5 enzymatic activity be reliably measured in vitro?

The recommended protocol for measuring AGPAT5 activity involves:

• Reaction Assembly:

  • Combine 60 μM acyl-CoA with 150-80 μM lysophosphatidic acid spiked with [14C]-labeled substrate

  • Use radiolabeled tracers such as [14C]-glycerol-3-phosphate to allow quantification

• Assay Conditions:

  • Conduct reactions at 37°C for 10 minutes

  • Stop reactions with chloroform:methanol (2:1)

  • Extract lipids using the Bligh and Dyer method

  • Separate lipids by thin-layer chromatography

  • Quantify product formation using a phosphorimager

• Controls and Validation:

  • Include vector-only or β-galactosidase (LacZ) adenovirus-infected cell lysates as negative controls

  • Use known AGPAT family member (such as AGPAT1) as a positive control

  • Perform substrate and enzyme concentration gradient analyses to ensure linearity of the reaction

This methodology allows for accurate determination of specific activity and substrate preferences of recombinant AGPAT5.

How is AGPAT5 expression altered in colorectal cancer, and what are the functional implications?

AGPAT5 exhibits significant expression changes in colorectal cancer (CRC) with important clinical correlations:

• Expression Pattern:

  • AGPAT5 expression is significantly decreased in CRC cell lines (HCT116 and SW480) compared to normal human intestinal epithelial cells (HIECs)

  • Expression is negatively correlated with clinical stage progression, with lower levels observed in advanced stages (I-IV)

  • RT-qPCR assays confirm downregulation in tumor tissues compared to matched normal tissues

• Functional Impact:

  • Overexpression experiments demonstrate that AGPAT5 acts as a tumor suppressor:

    • Significantly inhibits proliferation of HCT116 and SW480 cells (confirmed by CCK-8 assay)

    • Increases cell apoptotic rates (verified by flow cytometry)

    • Reduces cell migration (demonstrated by wound healing assay)

• Clinical Significance:

  • Low AGPAT5 expression correlates with:

    • Advanced clinical stage

    • Poorer prognosis

    • Lymph node metastasis

  • Analysis by JT test shows progressive decrease in AGPAT5 expression from stage I to IV CRC

This data suggests that AGPAT5 functions as a tumor suppressor in CRC, with its decreased expression potentially contributing to cancer progression through increased cell proliferation, decreased apoptosis, and enhanced migration capabilities.

What methods are most appropriate for investigating AGPAT5's role in cancer progression?

Based on published research protocols, the following methodological approaches are recommended:

• Expression Analysis:

  • RT-qPCR using primers:

    • AGPAT5-F: 5′-CTGGTGCTCCACACGTACTC-3′

    • AGPAT5-R: 5′-CCAGGCCAACACGTAGGTG-3′

    • GAPDH-F: 5′-GAAGGTGAAGGTCGGAGTC-3′

    • GAPDH-R: 5′-GAAGATGGTGATGGGATTT-3′ (internal control)

  • Calculate expression using the 2^-ΔΔCt method

• Functional Studies:

  • Overexpression: Transfect cells with pcDNA3.1-AGPAT5 vector using Lipofectamine 2000

  • Proliferation Assay: Seed 5×10^3 cells in 96-well plates and measure with CCK-8 at 0, 24, 48, and 72h

  • Apoptosis Analysis: Use flow cytometry with appropriate staining

  • Migration Assessment: Employ wound healing assay with analysis at 48h post-wounding

• Clinical Correlation:

  • Analyze TCGA-COADREAD datasets using the JT test to correlate expression with clinical stages

  • Validate findings using independent GEO datasets (e.g., GSE41258 and GSE42284)

  • Perform Kaplan-Meier survival analysis to correlate expression with patient outcomes

• Mechanism Investigation:

  • Pathway Analysis: Examine interaction with other cancer-related pathways

  • Copy Number Alteration: Assess whether genomic alterations contribute to expression changes

  • Microsatellite Instability Analysis: Compare AGPAT5 expression between MSI-H and MSI-L groups

These approaches provide a comprehensive framework for investigating AGPAT5's role in cancer, from basic expression analysis to functional characterization and clinical correlation.

How does AGPAT5 influence neural function and metabolic regulation?

Recent research has revealed a critical role for AGPAT5 in neuronal function, particularly in metabolic sensing:

• Neuronal Population Specificity:

  • AGPAT5 expressed in agouti-related peptide (AgRP) neurons is essential for:

    • Neuronal activation during hypoglycemia

    • Hypoglycemia-induced vagal nerve activity

    • Glucagon secretion in response to low blood glucose

• Metabolic Sensing Mechanism:

  • AGPAT5 partitions fatty acyl-CoAs away from mitochondrial fatty acid oxidation

  • This ensures that decreased ATP levels, which trigger neuronal firing, accurately reflect glycemia changes

  • AGPAT5 inactivation leads to:

    • Increased fatty acid oxidation

    • Enhanced ATP production

    • Impaired hypoglycemia sensing

• Functional Consequences of AGPAT5 Knockout:

  • Mice with AGPAT5 inactivation in AgRP neurons (Agpat5KO^AgRP mice) show:

    • Reduced activation of AgRP neurons during hypoglycemia (assessed by c-Fos immunostaining)

    • Defective activation of the vagal nerve

    • Significantly decreased plasma glucagon levels during hypoglycemia challenges

    • Higher glucose infusion rates required during hypoglycemic clamps

This research demonstrates that AGPAT5 plays a crucial role in the glucose-sensing capabilities of specific neuron populations, with direct implications for systemic glucose homeostasis and counterregulatory responses to hypoglycemia.

What experimental approaches are most effective for studying AGPAT5 in neuronal contexts?

Based on successful published research, the following methodological approaches are recommended:

• Genetic Models:

  • Generate conditional knockout models using Cre-lox system:

    • Cross Agpat5^flox/flox mice with neuron-specific Cre lines (e.g., AgRP-Cre)

    • Include reporter genes (e.g., Rosa26^tdTom) to visualize affected neurons

• Validation of Knockout:

  • Confirm recombination specificity using PCR and fluorescence microscopy

  • Quantify neuronal populations to ensure no developmental effects

  • Assess baseline metabolic parameters (body weight, glucose tolerance)

• Functional Assessments:

  • Hypoglycemia Response:

    • Insulin tolerance tests with blood glucose and hormone measurements

    • Hyperinsulinemic-hypoglycemic clamps to measure glucose infusion rates

    • Plasma glucagon measurement during controlled hypoglycemia

• Neuronal Activity Analysis:

  • Ex vivo: Patch-clamp electrophysiology on acute brain slices to assess glucose responsiveness

  • In vivo: Fiber photometry to monitor real-time neuronal activity

  • Post-mortem: c-Fos immunofluorescence microscopy after hypoglycemic challenge

• Metabolic Pathway Investigation:

  • Electron microscopy analysis of mitochondrial morphology

  • Oxygen consumption rate (OCR) measurements

  • ATP production assays

  • Fatty acid oxidation assessment with appropriate inhibitors (e.g., etomoxir for Cpt1a)

These techniques provide a comprehensive toolkit for investigating AGPAT5's role in neuronal function and metabolic regulation, from genetic manipulation to functional outcomes at cellular and systemic levels.

What are the most effective methods for creating AGPAT5 expression constructs?

Based on successful published protocols, the following approaches are recommended for generating AGPAT5 expression constructs:

• Epitope-Tagged Constructs:

  • V5-Tagged AGPAT5:

    • Amplify the full-length ORF (GenBank accession NM_018361)

    • Add V5-epitope tag at the amino-terminus using primers:

      • Forward: 5′-CCGCTCGAGATG GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG ACGCTGCTGTCCCTGGTGCTCCACACG-3′

      • Reverse: 5′-CCCAAGCTTCTATGCTTTAATAGTAACCC-3′

    • Clone into appropriate expression vector (e.g., pShuttle-CMV)

• Fluorescent Fusion Proteins:

  • EGFP-Tagged AGPAT5:

    • Amplify the ORF using primers:

      • Forward: 5′-CCGCTCGAGATGCTGCTGTCCCTG-3′

      • Reverse: 5′-CCGGAATTCTGCTTTAATAGTAAC-3′

    • Digest with XhoI and EcoRI

    • Clone into pEGFP-N3 (or similar vector)

    • Verify junction sequences by sequencing

• Adenoviral Expression Systems:

  • Digest the shuttle vector containing AGPAT5 with PmeI

  • Co-transform with pAdEasy-1 into BJ5183 cells for homologous recombination

  • Verify recombinant plasmid by PacI digestion and transfect into AD293 cells

  • Propagate virus in AD293 cells and purify using appropriate purification kit

• Expression Validation:

  • Confirm expression by Western blot using either:

    • Anti-V5 antibody for V5-tagged constructs

    • Anti-GFP antibody for EGFP fusion proteins

  • Verify enzymatic activity using standard AGPAT assays

These methods have proven effective for generating functional AGPAT5 expression constructs suitable for biochemical characterization, subcellular localization studies, and functional assessments in cellular models.

What methodological considerations are important when analyzing AGPAT5 expression in tissue samples?

For accurate analysis of AGPAT5 expression in biological samples, consider these methodological guidelines:

• RNA Extraction and Quality Control:

  • Extract total RNA using validated methods appropriate for tissue type

  • Assess RNA integrity by gel electrophoresis or Bioanalyzer (RIN > 7 recommended)

  • Perform DNase treatment to eliminate genomic DNA contamination

• Quantitative PCR:

  • Primer Design:

    • AGPAT5-F: 5′-CTGGTGCTCCACACGTACTC-3′

    • AGPAT5-R: 5′-CCAGGCCAACACGTAGGTG-3′

  • Reference Genes:

    • GAPDH (standard for many tissue types)

    • Multiple reference genes should be validated for specific tissue types

  • Analysis Method:

    • 2^-ΔΔCt method with appropriate controls

    • Standard curves for absolute quantification when comparing across tissues

• Tissue-Specific Considerations:

  • Ensure proper normalization strategies when comparing different tissues

  • For clinical samples:

    • Use matched normal-tumor pairs when possible

    • Document clinical parameters (stage, grade, treatment status)

    • Consider microsatellite instability status in colorectal samples

• Statistical Analysis:

  • For stage-associated expression:

    • JT test for trend analysis across progressive stages

    • t-test or ANOVA with multiple comparisons for group differences

  • For survival analysis:

    • Kaplan-Meier analysis with log-rank test

    • Cox proportional hazards model for multivariate analysis

  • Set significance threshold at p < 0.05 after appropriate multiple testing correction

These methodological considerations ensure reliable and reproducible analysis of AGPAT5 expression patterns across different experimental and clinical contexts.

How can contradictory findings in AGPAT5 research be reconciled?

Researchers may encounter seemingly contradictory results regarding AGPAT5 function across different studies. Here are methodological approaches to resolve these contradictions:

• Tissue and Context Specificity:

  • AGPAT5 functions may differ fundamentally between tissues:

    • Acts as a tumor suppressor in colorectal cancer

    • Plays a metabolic sensing role in hypothalamic neurons

  • Recommendation: Always include tissue-specific positive controls and validate findings across multiple cell lines or primary cultures

• Isoform Specificity and Classification:

  • Confusion may arise from historical nomenclature issues:

    • Some studies have reclassified certain AGPAT isoforms as GPAT enzymes

    • AGPAT10 was later reclassified as GPAT3

  • Recommendation: Clearly document which GenBank accession numbers were used and consider testing multiple family members in parallel

• Substrate Availability and Specificity:

  • Enzymatic activities may vary based on:

    • Substrate concentrations used in assays

    • Acyl-CoA chain length and saturation

    • Lysophospholipid backbone structure

  • Recommendation: Perform comprehensive substrate panels with concentration gradients

• Experimental System Limitations:

  • Overexpression systems may alter normal membrane topology or protein interactions

  • Knockout models may trigger compensatory mechanisms

  • Recommendation: Utilize multiple complementary approaches (overexpression, knockdown, knockout) and validate with rescue experiments

• Data Integration Approach:

  • When faced with contradictory findings, consider:

    • Performing meta-analysis of available datasets

    • Utilizing multi-omics approaches (transcriptomics, proteomics, lipidomics)

    • Developing computational models that can incorporate context-dependent function

By systematically addressing these potential sources of contradiction, researchers can develop a more nuanced understanding of AGPAT5's diverse functions in different biological contexts.

What are the emerging research directions in AGPAT5 biology?

Based on current literature and evolving research trends, several promising research directions for AGPAT5 are emerging:

• Integration with Systems Biology:

  • Positioning AGPAT5 within comprehensive lipid metabolic networks

  • Developing computational models of phospholipid biosynthesis pathways

  • Multi-omics integration to understand regulatory mechanisms

• Therapeutic Applications in Oncology:

  • Developing methods to restore AGPAT5 expression in colorectal cancer

  • Exploring AGPAT5 as a prognostic biomarker for cancer staging

  • Investigating connections between AGPAT5 and microsatellite instability

• Metabolic Disease Applications:

  • Targeting AGPAT5 in hypothalamic neurons to modulate glucose sensing

  • Investigating potential roles in diabetes and hypoglycemia management

  • Exploring connections to fatty acid metabolism disorders

• Structural Biology Approaches:

  • Determining the three-dimensional structure of AGPAT5

  • Structure-based design of specific inhibitors or activators

  • Engineering AGPAT5 variants with altered substrate specificity

• Advanced Imaging Applications:

  • Developing techniques to visualize AGPAT5-dependent lipid metabolism in real-time

  • Applying super-resolution microscopy to study mitochondrial membrane dynamics

  • Using FRET sensors to monitor AGPAT5 interactions with other proteins

These research directions represent promising avenues for advancing our understanding of AGPAT5 biology and developing potential therapeutic applications based on its diverse functions.