Recombinant Human 2-acylglycerol O-acyltransferase 2 (MOGAT2)

What is MOGAT2 and what is its primary function in human metabolism?

MOGAT2 (Monoacylglycerol O-acyltransferase 2) is an enzyme that catalyzes the conversion of monoacylglycerol (MAG) to diacylglycerol (DAG) in the triacylglycerol (TAG) synthesis pathway. It generates precursors for glycerophospholipids and triacylglycerols, playing a crucial role in dietary fat absorption primarily in the small intestine . MOGAT2 is part of the metabolic pathway that processes dietary fats for storage or utilization in the body.

Methodological approach for researchers: When studying MOGAT2 function, consider both its direct enzymatic activity in the MAG→DAG conversion and its broader metabolic impacts. Functional assays should measure not only the conversion rate but also downstream effects on lipid accumulation, energy expenditure, and metabolic parameters.

How does MOGAT2 deficiency affect metabolic health in animal models?

MOGAT2 knockout mice (Mogat2−/− mice) display several beneficial metabolic phenotypes:

• Resistance to high-fat diet-induced obesity

• Improved insulin sensitivity

• Decreased fat accumulation in liver and adipose tissue

• Increased levels of gut incretin glucagon-like peptide-1 (GLP-1)

• Enhanced energy expenditure

• Preference for carbohydrates over fats in diet

Importantly, adult-onset MOGAT2 deficiency (using tamoxifen-inducible Cre recombinase) also protects against diet-induced weight gain, hepatic steatosis, and glucose intolerance. Inactivating MOGAT2 in already obese mice reduces body weight and improves glucose tolerance .

Methodological consideration: When designing knockout experiments, researchers should distinguish between germline knockouts and adult-onset deficiency models, as the latter may be more relevant for therapeutic applications.

What are the established methods for measuring MOGAT2 enzymatic activity?

Researchers have several methodological options for measuring MOGAT2 activity:

The cell-based assay using murine secretin tumor cell-1 line of enteroendocrine origin has been successfully used to screen and evaluate MOGAT2 inhibitors .

What is the tissue distribution pattern of MOGAT2 expression in humans?

Methodological approach: For expression studies, quantitative PCR with specific primers and probes is recommended. Immunohistochemistry can be used to visualize protein localization, as demonstrated in studies examining MOGAT2 in tumor samples .

How does MOGAT2 correlate with clinical outcomes in cancer?

Methodological note: When studying MOGAT2 in cancer tissues, researchers should use appropriate scoring systems that account for both the percentage of positively stained tumor cells and the intensity of staining on a standardized scale .

How can one generate functional recombinant human MOGAT2 for experimental studies?

For researchers needing to produce recombinant human MOGAT2, several expression systems have been validated:

• Adenoviral expression system approach:

  • Amplify MOGAT2 coding sequence using primers:

    • Forward: 5′-CACCATGGAGCTGTGGCCGTG-3′

    • Reverse: 5′-CTACTGGGCCGGCTGCACGC-3′

  • Clone the PCR product into appropriate entry vector (e.g., pENTR/D-TOPO)

  • Perform recombination with destination vector (e.g., pAd/CMV/V5-DEST)

  • Transfect into packaging cells using appropriate transfection reagent

• Alternative approach:

  • Amplify using primers:

    • Forward: 5′-GGAAGATCTATGGAGCTGTGGCCGTGTCTG-3′

    • Reverse: 5′-CCGCTCGAGCTACTGGGCCGGCTGCACGC-3′

  • Clone into TA-cloning vector, sequence, restrict with XhoI

  • Subclone into pShuttle-CMV vector

For purification, CsCl purification is recommended for in vivo applications .

Methodological consideration: Verify the enzymatic activity of recombinant MOGAT2 before using it in functional studies, as protein production does not guarantee functional activity.

What compensatory mechanisms activate when MOGAT2 is depleted?

An important consideration for MOGAT2-targeted therapies is the compensatory mechanisms that engage upon MOGAT2 depletion:

• DGAT upregulation: DGAT1 and DGAT2 are significantly upregulated in the gastrointestinal tract of MOGAT2-deficient mice.

• Negative correlation: TCGA data analyses show that reduction of MOGAT2 mRNA levels negatively correlates with increased DGAT1 and DGAT2 mRNA levels in normal tissues adjacent to breast cancer.

• Functional substitution: Both DGAT1 and DGAT2 appear to act as functional substitutes in MOGAT2−/−PyMT mice .

• Tissue specificity: This compensation occurs primarily in gastrointestinal tissues, while MOGAT1 expression remains unaltered in MOGAT2-deficient systems .

Methodological implication: When targeting MOGAT2 therapeutically, researchers should monitor DGAT1/2 expression and activity to account for compensatory mechanisms that might affect long-term efficacy.

How should researchers design mammary tumor models to study MOGAT2's role in cancer?

Based on published methodologies, the following approach can be used to investigate MOGAT2's role in mammary tumors:

• Generate experimental animals:

  • Cross MOGAT2 knockout mice with MMTV-PyMT mice to produce F2 Mogat2+/+PyMT and Mogat2−/−PyMT female mice

• Tissue analysis methods:

  • For mammary gland development: Whole-mount carmine alum staining

    • Fix inguinal mammary glands in Carnoy's solution (75% absolute ethanol, 25% glacial acetic acid)

    • Wash with 70% ethanol for 30 min

    • Gradually rinse in water

    • Stain with carmine alum for at least two days

  • For lung metastasis evaluation:

    • Fix lungs in Bouin's solution

    • Count metastatic lesions larger than 0.5 mm in diameter macroscopically

• Tumor progression monitoring:

  • Weekly palpation to assess number of tumor-affected mammary glands

  • Measurement of total tumor volume

• Gene expression analysis:

  • Collect mammary tumors and other tissues (e.g., gastrointestinal tissues)

  • Store in RNA preservation reagent

  • Extract RNA using Trizol reagent

  • Perform reverse transcription and qPCR

  • Analyze using the 2−ΔΔCt method with appropriate normalization genes (e.g., β-actin)

How do dietary factors influence MOGAT2 function and experimental outcomes?

Dietary factors significantly impact MOGAT2 function and experimental outcomes, creating important methodological considerations:

• Fat content discrepancies:

  • Studies using diets with 60% calories from fat showed MOGAT2 ablation protected against obesity

  • Research using 37% fat content diets found no protection against diet-induced obesity and subsequent mammary tumor formation

• Geographic dietary context:

  • Asian countries: relatively low total fat intake (<30% total energy)

    • China: 20% TE

    • India: 22.5% TE

    • South Korea: 21.1% TE

    • Japan: 23.3–26.3% TE

  • Western countries: higher total fat intake (>30% TE)

    • USA: 34% TE

    • Germany: 37.6% TE

    • France: 38.2% TE

• Experimental design implications:

  • The 37% fat diet more closely resembles human dietary habits in Western countries

  • Researchers should consider both the percentage and composition of dietary fats

  • Diet composition can modify phenotypic effects of MOGAT2 deficiency

Methodological recommendation: Clearly report diet composition in all MOGAT2 studies, and consider testing multiple diet conditions to understand context-dependent effects.

What techniques are recommended for developing and validating MOGAT2 inhibitors?

For researchers developing MOGAT2 inhibitors, a systematic approach is recommended:

• Cell-based assay development:

  • Construct human MOGAT2-expressing recombinant cell lines (e.g., using murine secretin tumor cell-1 line)

  • Implement high-resolution LC/MS platform to monitor incorporation of stable isotope-labeled D31-palmitate into DAG

  • This approach provides several advantages over traditional TLC methods:

    • Dramatic reduction in background interference

    • Increased sensitivity and signal window

    • Selective tracing of cellular DAG synthesis activity

• Validation criteria:

  • Characterize inhibitors from different chemotypes to establish structure-activity relationships

  • Test compounds in both cellular and animal models to confirm target engagement

  • Evaluate effects on metabolic parameters (insulin sensitivity, hepatic steatosis, etc.)

  • Monitor compensatory upregulation of DGAT1/2 as a potential resistance mechanism

• Translation to therapeutic applications:

  • Target validation data shows MOGAT2 inhibition is efficacious even in adult onset models

  • Adult patients with metabolic disorders are likely to respond to treatment

  • Focusing on intestinal MOGAT2 inhibition may be sufficient for therapeutic benefit

What are the key primers and protocols for MOGAT2 gene expression analysis?

For researchers conducting gene expression analysis of MOGAT2, the following validated protocols are recommended:

• RNA extraction:

  • Harvest tissues and store in RNA preservation reagent

  • Extract total RNA using Trizol reagent (Invitrogen)

  • Perform reverse transcription using a commercial kit (e.g., PrimeScriptTM II 1st Strand cDNA Synthesis Kit)

• qPCR reaction:

  • Use Roche LightCycler 480 System or similar platform

  • Use β-actin as normalization gene

  • Calculate relative expression using 2−ΔΔCt method

• For human AGPAT1 (related enzyme) amplification:

  • Forward: 5′-GGTACTCGCAACGACAATGG-3′

  • Reverse: 5′-TTGGTGTTGTAGAAGGAGGAGAAG-3′

  • 6-carboxyfluorescein-labeled probe: CACAGGTGCCCATCGTCCCC

• For MOGAT2:

  • Forward: 5′-AACGTGGCGCCTTCCA-3′

  • Reverse: 5′-GAAGTCTTGGTAGGAGGACATGACT-3′

  • 6-carboxyfluorescein-labeled probe: CTTGCAGTGCAGGCCCAGGTTC

Methodological consideration: Always include appropriate positive and negative controls, and validate primer specificity before conducting expression studies.

How should researchers interpret conflicting energy expenditure data in MOGAT2-deficient models?

Published literature presents conflicting data regarding energy expenditure in MOGAT2-deficient mice:

• Conflicting observations:

  • Nelson et al.: Increased energy expenditure in Mogat2−/− mice is independent of diet type (observed with both normal chow and high-fat diet)

  • Mul et al.: Mogat2−/− mice only showed increased energy expenditure when fed a high-fat diet, not with normal chow

• Interpretation framework:

  • Consider methodological differences in energy expenditure measurement

  • Analyze dietary composition differences (60% vs. 37% fat content)

  • Evaluate developmental timing (germline vs. adult-onset knockout)

  • Examine additional parameters (food intake, locomotor activity, substrate preference)

  • Note that Mogat2−/− mice show preference for carbohydrates over fat, correlating with increased locomotor activity

Methodological recommendation: When studying energy expenditure in MOGAT2-deficient models, researchers should standardize measurement protocols, clearly define diet composition, and consider multiple metabolic parameters simultaneously to develop a comprehensive understanding.

What are the key unanswered questions about MOGAT2 in metabolic diseases?

Despite significant progress in understanding MOGAT2, several important questions remain:

• Molecular mechanisms:

  • How does MOGAT2 deficiency lead to increased GLP-1 secretion?

  • What signaling pathways mediate the metabolic benefits of MOGAT2 inhibition?

  • How does MOGAT2 interact with other lipid metabolism enzymes in different tissues?

• Translational questions:

  • Would partial inhibition of MOGAT2 provide metabolic benefits without compensatory upregulation?

  • Is intestine-specific inhibition sufficient for therapeutic benefit?

  • What is the role of liver MOGAT2 expression in human metabolic diseases?

Methodological approach: Address these questions through tissue-specific knockout models, combined with molecular and biochemical analyses of metabolic pathways.

How can researchers reconcile the apparent discrepancy between MOGAT2's role in cancer and metabolism?

The search results reveal an interesting paradox:

Methodological approach to resolve this discrepancy:

• Study MOGAT2 in multiple cancer models beyond MMTV-PyMT

• Investigate cancer-specific compensatory mechanisms

• Examine cell-autonomous versus non-cell-autonomous effects

• Consider context-dependent functions in different genetic backgrounds

This area represents an important frontier for future research, requiring careful experimental design to understand tissue-specific and context-dependent roles of MOGAT2.

What are the critical methodological considerations for MOGAT2 research?

Based on the available literature, researchers studying MOGAT2 should consider:

• Compensatory mechanisms: Always monitor DGAT1/2 expression when studying MOGAT2 deficiency, as these enzymes can functionally substitute for MOGAT2 .

• Dietary context: The percentage of fat in experimental diets significantly impacts results, with 37% fat diets more closely representing human consumption patterns than 60% fat diets .

• Developmental timing: Distinguish between germline and adult-onset MOGAT2 deficiency, as they may have different phenotypic consequences .

• Tissue specificity: Consider that MOGAT2 may have distinct functions in different tissues, requiring tissue-specific investigation approaches .

• Assay selection: For inhibitor development, high-resolution LC/MS platforms offer significant advantages over traditional TLC methods .