Recombinant Human C-C motif chemokine 26 protein (CCL26) (Active)

What is CCL26 and what are its alternative names in scientific literature?

CCL26 (C-C motif chemokine ligand 26) is also known by several alternative names including Eotaxin-3, SCYA26 (Small Inducible Cytokine Subfamily A Member 26), Thymic Stroma Chemokine-1 (TSC-1), IMAC, MIP-4alpha, and MIP4a. This CC chemokine maps to chromosome 7q11.2, within 40 kilobases of the Eotaxin-2 loci. It belongs to the platelet factor-4 family of chemokines and functions as a ligand for multiple receptors, most notably CCR3.

What is the molecular structure of human CCL26?

Human CCL26 cDNA encodes a 94 amino acid (aa) residue protein with a putative signal peptide of either 23 or 26 aa residues. The mature recombinant form typically consists of 68-72 amino acid residues (Ser27-Leu94), forming a disulfide-linked homodimeric protein that migrates as an approximately 9 kDa protein under both reducing and non-reducing conditions in SDS-PAGE. Like other CC chemokines, it contains four conserved cysteine residues, with two adjacent to each other, which are critical for its structural integrity and biological function.

What is the normal tissue distribution and expression pattern of CCL26?

CCL26 has been shown to be constitutively expressed in the heart and ovary. Additionally, low levels of CCL26 expression can be detected in various other tissues throughout the body. Its expression pattern differs from other eotaxins, providing tissue-specific regulation of eosinophil recruitment. In vascular endothelial cells, CCL26 expression is significantly upregulated by IL-13 and IL-4, which are Th2 cytokines associated with allergic responses.

How does recombinant human CCL26 differ when produced in different expression systems?

Recombinant human CCL26 has been produced in different expression systems with varying characteristics:

The E. coli-derived protein is typically purified to ≥97% by SDS-PAGE and HPLC, with endotoxin levels <0.1 ng/μg (1 EU/μg) when tested using the LAL gel clot method.

Which receptors does CCL26 interact with and what are their relative binding affinities?

CCL26 demonstrates a complex receptor interaction profile with both agonistic and antagonistic activities:

• CCR3 (Primary receptor): CCL26 is a functional ligand for CCR3, though its binding affinity is approximately 10-fold less than that of eotaxin/CCL11. Through this receptor, it induces chemotaxis of eosinophils and PHA-activated T cells.

• CX3CR1: Surprisingly, CCL26 also functions as an agonist for CX3CR1 (the receptor for fractalkine/CX3CL1). This interaction occurs at relatively high concentrations and has been verified through calcium flux and chemotaxis assays in human CX3CR1-expressing cells (but not mouse CX3CR1).

• Antagonistic interactions: CCL26 acts as a natural antagonist for CCR1, CCR2, and CCR5, adding another layer of complexity to its immunological functions.

• Species specificity: Notably, while CCL26 can activate human CX3CR1, it does not have the same effect on mouse CX3CR1, highlighting important species differences in receptor interactions.

How does CCL26 induce cellular responses through its receptors?

CCL26 binding to its receptors triggers several cellular responses:

How does CCL26 differ from other eotaxins in terms of receptor engagement and function?

While CCL26 shares the CCR3 receptor with other eotaxins, it has several distinguishing features:

• Binding affinity: CCL26 binds to CCR3 with approximately 10-fold lower affinity than eotaxin/CCL11.

• Unique receptor interactions: Unlike other eotaxins, CCL26 is a functional agonist for CX3CR1 and an antagonist for CCR1, CCR2, and CCR5.

• Dual role in allergic diseases: CCL26 plays a unique dual role in allergic diseases by attracting eosinophils via CCR3 and killer lymphocytes and resident monocytes via CX3CR1, potentially contributing to both the initial allergic response and subsequent tissue damage or regulation.

• Regulation: CCL26 participates in the regulation of its own receptor (CCR3) and modulates the expression of various chemokines in alveolar type II cells, suggesting a complex feedback mechanism not established for other eotaxins.

What are the optimal conditions for using recombinant CCL26 in cell migration assays?

For optimal results in cell migration assays using recombinant CCL26:

• Concentration range: For eosinophil chemotaxis, the effective concentration range is typically 50-100 ng/ml. For calcium flux assays through CCR3, a similar range is effective, while higher concentrations may be needed for CX3CR1-mediated responses.

• Buffer conditions: Recombinant CCL26 is typically lyophilized from 0.2 μm filtered PBS, pH 7.5 with 10% glycerol. Reconstitution should maintain these conditions for optimal activity.

• Cell types: The assay can be performed with:

  • Primary eosinophils purified from human blood

  • CCR3-transfected cell lines (e.g., L1.2 cells)

  • CX3CR1-expressing cells (for alternative pathway studies)

  • Human PBMCs to assess migration of CD16+ NK cells, CD45RA+CD27−CD8+ T cells, and CD14lowCD16high monocytes

• Controls: Include positive controls with established CCR3 ligands like eotaxin/CCL11, and negative controls with chemically inactivated CCL26 or irrelevant chemokines.

How can researchers effectively use RNA interference to study CCL26 function in cell culture models?

Based on successful siRNA targeting of CCL26 in alveolar type II cells (A549 cell line model), the following methodology is recommended:

• siRNA design and selection: Target-specific siRNA duplexes against CCL26 mRNA should be designed. In previous research, duplexes targeting different regions showed varying efficacy, with duplexes 6 and 8 being most effective (sequences provided below).

  Duplex	Sense Sequence	Antisense Sequence	Efficacy
  5	GAAAGUCUGUACCCAUCCAAUU	5′-P.UGGAUGGGGUACAGACUUUCUU	Moderate
  6	GCUAUGAAUUCACCAGUAAUU	5′-P.UUACUGGUGAAUUCAUAGCUU	High
  7	CCGAAACAAUUGUGACUCAUU	5′-P.UGAGUCACAAUUGUUUCGGUU	Moderate
  8	GAUAUUCACUACCAAAAAGAUU	5′-P.UCUUUUGGUAGUGAAUAUCUU	High

• Transfection protocol:

  • Plate cells at approximately 2 × 10^5 cells/mL

  • Use appropriate transfection reagents (e.g., DharmaFECT 1)

  • Include proper controls (non-targeting siRNA pool)

  • For A549 cells, IL-4 stimulation (10 ng/mL) after transfection can be used to induce CCL26 expression

• Validation methods:

  • RT-PCR to confirm reduction in CCL26 mRNA levels

  • ELISA to measure CCL26 protein in cell supernatants

  • Functional assays (chemotaxis, calcium flux) to confirm biological impact

• Expected outcomes: Effective siRNA treatment should reduce IL-4-stimulated CCL26 mRNA and protein expression by >70%. The most effective duplexes (6 and 8) achieved nearly complete suppression in previous studies.

What methods can be used to assess the functional activity of recombinant CCL26 in vitro?

Several methods can be used to assess the functional activity of recombinant CCL26:

• Calcium flux assays:

  • Load cells (eosinophils, CCR3-transfected cells, or CX3CR1-expressing cells) with calcium-sensitive dyes

  • Measure intracellular calcium concentration changes following CCL26 stimulation

  • Typically performed with a fluorescence plate reader or flow cytometer

• Chemotaxis assays:

  • Transwell migration assays with CCL26 in the lower chamber

  • Quantify migrated cells (eosinophils, T cells, NK cells, monocytes) after incubation

  • Effective CCL26 should induce dose-dependent migration of CCR3+ or CX3CR1+ cells

• Receptor binding assays:

  • Competitive binding assays using labeled ligands (e.g., [125I]-labeled CCL11 or CX3CL1)

  • Flow cytometry with fluorescently labeled antibodies to detect receptor internalization

  • Surface plasmon resonance to measure binding kinetics

• Cell activation markers:

  • Measure expression of activation markers on target cells

  • Assess production of reactive oxygen species or release of granule proteins from eosinophils

  • Quantify cytokine/chemokine production in response to CCL26

• Receptor cross-desensitization studies:

  • Pre-treat cells with CCL26 and measure responses to subsequent stimulation with other chemokines

  • Evaluate CCL26's ability to antagonize CCR1, CCR2, and CCR5 responses

How can CCL26's dual role through CCR3 and CX3CR1 be experimentally dissected?

To investigate CCL26's dual functionality through different receptors:

• Receptor-specific cell models:

  • Use cell lines expressing only CCR3 (e.g., transfected L1.2 cells) or only CX3CR1

  • Compare responses in wild-type cells versus receptor-knockout models

  • Employ primary cells with differential receptor expression (eosinophils primarily express CCR3, while CD16+ NK cells express CX3CR1)

• Receptor blocking strategies:

  • Use receptor-specific blocking antibodies (anti-CCR3 or anti-CX3CR1)

  • Apply receptor-specific antagonists

  • Compare with receptor-specific agonists (CCL11 for CCR3, CX3CL1 for CX3CR1)

• Concentration-dependent effects:

  • Test a wide concentration range of CCL26 (10-1000 ng/mL)

  • CX3CR1 activation typically requires higher CCL26 concentrations than CCR3 activation

  • Establish dose-response curves for different receptor-mediated functions

• In vivo models:

  • Compare CCL26 effects in wild-type, CCR3-knockout, and CX3CR1-knockout mice

  • Use adoptive transfer of human cells expressing specific receptors into immunodeficient mice

  • Combine with cell type-specific depletion strategies to isolate receptor contributions

What are the most common challenges in studying CCL26 function and how can they be addressed?

Researchers commonly encounter these challenges when studying CCL26:

• Receptor promiscuity and cross-talk:

  • Challenge: CCL26 interacts with multiple receptors (CCR3, CX3CR1) and acts as an antagonist for others

  • Solution: Use receptor-selective cell systems, knockout models, or receptor-specific inhibitors to isolate individual pathways

  • Consider combination experiments with other chemokines to understand physiological context

• Species differences:

  • Challenge: Human CCL26 activates human CX3CR1 but not mouse CX3CR1

  • Solution: Use humanized mouse models or human cell xenografts for in vivo studies

  • Be cautious when extrapolating between species; always validate in human systems

• Protein stability and activity:

  • Challenge: Recombinant CCL26 may lose activity during storage or experimental manipulation

  • Solution: Store lyophilized protein at -20°C or -80°C

  • Avoid repeated freeze-thaw cycles of reconstituted protein

  • Include freshly prepared positive controls in functional assays

• Contextual effects in complex systems:

  • Challenge: CCL26 effects may differ in simple cell culture versus complex inflammatory environments

  • Solution: Use co-culture systems with multiple cell types

  • Compare results from stimulated versus unstimulated conditions (e.g., with IL-4/IL-13)

  • Validate findings in ex vivo human samples from relevant disease states

How can researchers investigate CCL26's role in regulating other chemokines in alveolar epithelial cells?

To study CCL26's regulatory effects on other chemokines:

• siRNA-based approaches:

  • Transfect alveolar epithelial cells (e.g., A549) with CCL26-targeted siRNA

  • Stimulate with IL-4 to induce chemokine expression

  • Measure expression of multiple chemokines (CCL5/RANTES, CCL15/MIP-1δ, CCL8/MCP-2, CCL13/MCP-4, CCL24) using:

    • ELISAs for protein quantification

    • qRT-PCR for mRNA expression analysis

    • Multiplex assays for comprehensive chemokine profiling

• Recombinant protein studies:

  • Treat cells with recombinant CCL26 at various concentrations

  • Compare with other CCR3 ligands to determine specificity

  • Assess changes in chemokine expression patterns

  • Include receptor antagonists to determine if effects are receptor-dependent

• Signaling pathway analysis:

  • Investigate whether CCL26's regulatory effects involve:

    • STAT6 signaling (downstream of IL-4/IL-13)

    • NF-κB pathway activation

    • MAPK signaling cascades

  • Use pathway inhibitors to block specific signaling components

  • Perform phosphorylation studies to track activation of signaling intermediates

• Functional consequences assessment:

  • Collect supernatants from CCL26-siRNA treated versus control cells

  • Test their effects on eosinophil migration and activation

  • Measure leukocyte adhesion to treated epithelial cells

  • Assess impact on epithelial barrier function or other aspects of cellular physiology

What experimental approaches can differentiate between CCL26's functions as both an agonist and antagonist for different chemokine receptors?

CCL26's complex role as both an agonist and antagonist can be investigated through:

• Sequential stimulation protocols:

  • Pre-treat cells with CCL26, then challenge with specific receptor agonists:

    • CCL11 (eotaxin) for CCR3

    • CCL3 (MIP-1α) for CCR1

    • CCL2 (MCP-1) for CCR2

    • CCL5 (RANTES) for CCR5

    • CX3CL1 (fractalkine) for CX3CR1

  • Measure calcium flux, chemotaxis, or other activation parameters

  • Determine if pre-treatment enhances (agonist) or inhibits (antagonist) the response

• Competitive binding assays:

  • Use radiolabeled or fluorescently labeled receptor-specific ligands

  • Compete with increasing concentrations of CCL26

  • Calculate binding affinities and inhibitory constants

  • Compare with known agonists and antagonists for each receptor

• Biased signaling investigation:

  • Examine different signaling pathways downstream of receptor activation:

    • G-protein coupling (Gαi, Gαq)

    • β-arrestin recruitment

    • Receptor internalization

  • Compare signaling profiles between CCL26 and canonical receptor ligands

  • Identify pathways preferentially activated or inhibited by CCL26

• Structure-function studies:

  • Use CCL26 mutants or truncated versions

  • Identify regions responsible for agonist versus antagonist functions

  • Compare with structural features of known receptor-specific ligands

  • Consider computational modeling to predict interaction interfaces

What are the most promising therapeutic applications of CCL26 research?

The unique properties of CCL26 suggest several therapeutic directions:

• Allergic disease treatments: CCL26-targeted therapies may help alleviate underlying inflammation in asthma and other allergic diseases. CCL26-siRNA approaches have demonstrated significant reduction in IL-4-induced inflammatory responses in alveolar epithelial cells, suggesting potential for RNA-based therapeutics.

• Dual-targeting approaches: CCL26's interactions with both CCR3 and CX3CR1 suggest that targeting this chemokine might address multiple aspects of allergic inflammation—both the initial eosinophil recruitment and the subsequent involvement of cytotoxic lymphocytes.

• Receptor-specific modulation: The antagonistic effects of CCL26 on CCR1, CCR2, and CCR5 could be leveraged to develop novel anti-inflammatory approaches that selectively inhibit specific receptor populations while preserving others.

• Biomarker development: CCL26 expression is dramatically upregulated in challenged asthmatics, suggesting potential use as a biomarker for allergic inflammation severity or treatment response.

What novel experimental models could advance our understanding of CCL26 biology?

Future research may benefit from these experimental approaches:

• Organoid and 3D culture systems: Developing airway epithelial organoids or lung-on-chip models to study CCL26 in more physiologically relevant contexts than traditional 2D cell culture.

• Single-cell analysis: Applying single-cell RNA sequencing and proteomics to identify cell-specific responses to CCL26 in heterogeneous tissues, potentially revealing previously unrecognized target populations.

• Humanized mouse models: Creating mice with human chemokine receptors to overcome species differences, particularly for CX3CR1-mediated functions where mouse and human receptors differ in CCL26 responsiveness.

• CRISPR-based screening: Using genome-wide CRISPR screens to identify novel components of CCL26 signaling pathways or regulatory networks controlling its expression and function.

• Systems biology approaches: Integrating transcriptomic, proteomic, and metabolomic data to build comprehensive models of CCL26's role in complex inflammatory networks.