Recombinant Human DBH-like monooxygenase protein 1 (MOXD1)

What is MOXD1 and what protein family does it belong to?

MOXD1 (Monooxygenase DBH-like 1) belongs to the copper-dependent monooxygenase family. It is predicted to enable copper ion binding activity and dopamine beta-monooxygenase activity . The protein is structurally similar to dopamine beta-hydroxylase (DBH) and is predicted to be involved in dopamine catabolic processes, norepinephrine biosynthetic processes, and octopamine biosynthetic processes . MOXD1 is believed to be located primarily in the endoplasmic reticulum membrane and is active in extracellular space and secretory granule membranes .

Where is MOXD1 primarily expressed during development and in adult tissues?

MOXD1 demonstrates highly specific expression patterns during development:

• It is expressed in migrating trunk neural crest cells

• MOXD1 is highly enriched in, and unique to, Schwann cell precursors (SCPs)

• Its expression is restricted to mesenchymal neuroblastoma cells and Schwann cell precursors during healthy development

In adult tissues, MOXD1 shows sexual dimorphism in specific brain regions, including the medial preoptic area (MPOA), bed nucleus of the stria terminalis (BNST), and amygdala . This suggests MOXD1 may play a role in sexually dimorphic brain functions.

What is the chromosomal location of the MOXD1 gene and its conservation across species?

The human MOXD1 gene is located at chromosome 6q23.2 . MOXD1 is highly conserved between humans and multiple translational models including chickens, mice, and zebrafish . This conservation suggests fundamental biological importance across vertebrate species, making it amenable to study in various model organisms.

How is MOXD1 involved in embryonic development?

MOXD1 plays a critical role in embryonic development:

• Cell type-specific loss of MOXD1 leads to disrupted organ homeostasis and failed adrenal gland formation, which is the primary site for neuroblastoma development

• MOXD1 knockout in trunk neural crest cells causes developmental delays in chick embryos, as measured by reduced Hamburger-Hamilton (HH) staging and fewer somite pairs

• When MOXD1-targeting CRISPR/Cas9 gRNAs were injected into chick embryos to target trunk neural crest cells specifically, embryo development was significantly delayed compared to controls

How does MOXD1 expression differ across various cancer types?

MOXD1 exhibits striking context-dependent functions across different cancer types:

This dual role highlights the tissue-specific nature of MOXD1 function and underscores the importance of tumor context in understanding its biological significance .

What molecular mechanisms explain MOXD1's varied effects in different cancers?

Several molecular mechanisms have been identified:

In GBM:

• MOXD1 can bind to β3GnT2 and affect glycosylation modification of proteins

• MOXD1 knockdown induces endoplasmic reticulum (ER) stress and triggers the ER-mitochondrial apoptosis pathway

• Knockdown affects expression of EMT markers (N-cadherin, β-catenin, Vimentin, E-cadherin) and matrix metalloproteinases (MMP2, MMP9)

In Neuroblastoma:

• MOXD1 expression is enriched in the mesenchymal (MES) subtype of neuroblastoma cells, which are generally less aggressive than adrenergic (ADRN) cells but more treatment-resistant

• MOXD1 expression coincides with Schwann cell precursor markers, suggesting a role in differentiation

• The tumor-suppressive function appears to be conserved across zebrafish, chick, and mouse models

What experimental models are suitable for studying MOXD1 function?

Multiple experimental models have proven effective for studying MOXD1:

• Cell culture: GBM cell lines (LN-229, U87 MG) ; Neuroblastoma cell lines (SH-EP, SK-N-BE(2)c, SK-N-SH, 691-ADRN)

• Xenograft models: Subcutaneous injection in mice

• Chorioallantoic membrane (CAM) assay: Implantation of MOXD1 knockout neuroblastoma cells in chick embryos

• Zebrafish models: CRISPR-mediated MOXD1 knockout and MYCN-driven neuroblastoma model

• Embryonic models: Conditional knockout in mice and CRISPR-mediated knockout in chick embryos

Each model provides complementary insights into MOXD1's developmental and pathological roles.

What techniques are most effective for MOXD1 knockdown or knockout studies?

Based on the search results, several effective techniques have been used:

• RNA interference: Short hairpin RNA (shRNA) sequences against MOXD1 (shMOXD1#2 and shMOXD1#3) effectively reduced both mRNA and protein levels in GBM cell lines

• CRISPR/Cas9: Multiple guide RNAs targeting MOXD1 at different genomic locations were used in chick embryos (MOXD1.1, MOXD1.2, MOXD1.3)

• CRISPR/Cas9 in zebrafish: crRNAs were designed and tested for efficiency, with crMOXD1_3 (GATGCTGGAGTCATCGAGAC) showing the highest efficiency

• Morpholino knockdown: Used in chick embryos for transient knockdown of MOXD1

For zebrafish studies, a systematic approach to crRNA selection was employed:

• Design five potential crRNAs using Benchling

• Test each crRNA's mutation efficiency

• Select the highest efficiency crRNA for subsequent experiments

How can MOXD1 protein expression be effectively measured in tissue samples?

Multiple complementary techniques have been used to assess MOXD1 expression:

• Quantitative RT-PCR (qRT-PCR) for mRNA levels

• Western blotting for protein expression in cell lines

• Immunohistochemistry for protein expression in tissue samples, which revealed heterogeneous expression patterns in neuroblastoma tumors

• Single-cell RNA sequencing (scRNA-seq) for cell type-specific expression analysis

For immunohistochemistry analysis of neuroblastoma samples, researchers quantified both the percentage of MOXD1-positive cells and the intensity of staining, finding correlation with patient age at diagnosis .

How does MOXD1 knockdown affect cell cycle progression and apoptosis?

MOXD1 knockdown in GBM cells induces multiple cellular changes:

Cell Cycle Effects:

• Induces cell cycle arrest at the G2/M phase

• Reduces expression of cell cycle-related proteins including CDK1, CDK2, Cyclin A1, and Cyclin B1

Apoptotic Effects:

• Triggers significant apoptosis in GBM cells as measured by Annexin V-FITC staining

• Damages mitochondrial membrane potential, as detected by JC-1 staining

• Increases reactive oxygen species (ROS) generation following mitochondrial damage

• Activates the mitochondrial apoptotic pathway, with changes in PARP, C-Caspase9, C-Caspase3, Bax, Bcl2, and Cytochrome C protein levels

These findings suggest MOXD1 normally promotes cell cycle progression and prevents apoptosis in GBM cells.

What is the relationship between MOXD1 and specific neuroblastoma subtypes?

MOXD1 expression is closely associated with neuroblastoma subtypes:

• MOXD1 is specifically expressed in mesenchymal (MES) neuroblastoma cells but absent in adrenergic (ADRN) cells

• MOXD1 co-expresses with the MES marker PRRX1

• Low MOXD1 expression correlates with more advanced tumor stages (INSS stages) and high-risk neuroblastomas

• MOXD1 protein expression correlates with age at diagnosis, with lower heterogeneity observed in children below 18 months

The MES neuroblastoma gene signature overlaps significantly with Schwann cell precursor markers, further connecting MOXD1's developmental and pathological roles .

What evidence supports MOXD1 as a tumor suppressor in neuroblastoma?

Multiple lines of evidence support MOXD1's tumor suppressor role in neuroblastoma:

Clinical correlations:

In vivo experimental evidence:

• MOXD1 knockout in neuroblastoma cells using the chick CAM assay increased tumor formation and cell motility

• MOXD1 overexpression in SK-N-BE(2)c cells delayed tumor formation in mouse xenograft models (mean time of 15 days vs. 9 days for control cells to reach 200 mm³)

• MOXD1 overexpression prolonged survival in multiple mouse models

• Fewer mice injected with MOXD1-overexpressing SK-N-SH cells developed tumors

• In a TH-MYCN-driven mouse model, MOXD1 expression steadily decreased with tumor progression

Together, these findings establish MOXD1 as a bona fide tumor suppressor in neuroblastoma.

How can the interaction between MOXD1 and β3GnT2 affect protein glycosylation?

MOXD1 has been shown to bind to β3GnT2 (Beta-1,3-N-acetylglucosaminyltransferase 2) and affect the glycosylation modification of some proteins in GBM cells . While the detailed mechanism of this interaction remains to be fully elucidated, several important considerations for researchers include:

• β3GnT2 is an enzyme involved in glycan synthesis, particularly in the formation of poly-N-acetyllactosamine structures

• Alterations in glycosylation can affect protein folding, stability, localization, and function

• Changes in glycosylation patterns are common in cancer and can influence cell adhesion, migration, and immune recognition

• This interaction could represent a novel mechanism by which MOXD1 influences tumor cell behavior

Methodological approaches to study this interaction could include:

• Co-immunoprecipitation to confirm direct protein-protein interaction

• Lectin blotting to assess changes in glycosylation patterns

• Mass spectrometry to identify specific glycosylated proteins affected

• Functional assays to determine the biological significance of the interaction

What therapeutic opportunities might arise from understanding MOXD1's role in cancer?

The context-dependent roles of MOXD1 suggest different therapeutic strategies:

For GBM:

• Inhibiting MOXD1 function or expression might be beneficial, given its oncogenic role

• Disrupting the MOXD1-β3GnT2 interaction could represent a novel therapeutic approach

• Targeting MOXD1-mediated glycosylation pathways might impair tumor growth and invasion

For Neuroblastoma:

• Strategies to restore or enhance MOXD1 expression could have therapeutic value

• Understanding the molecular basis of MOXD1's tumor-suppressive effects could identify downstream pathways for targeting

• The preferential expression of MOXD1 in mesenchymal neuroblastoma cells suggests potential for targeting specific tumor subpopulations

How might MOXD1 contribute to our understanding of neural crest cell development?

MOXD1's specific expression in neural crest-derived tissues provides valuable insights:

• Its expression in trunk neural crest cells and Schwann cell precursors makes it a useful lineage marker

• The phenotypes observed upon MOXD1 knockout highlight its role in proper developmental timing and organ formation

• The connection between MOXD1 and neuroblastoma offers a window into how disrupted developmental programs contribute to pediatric cancer

• Studying MOXD1 could help elucidate the mechanisms of neural crest cell migration, differentiation, and lineage specification

Further investigation of MOXD1's developmental functions may reveal fundamental principles of neural crest biology and illuminate the origins of neural crest-derived cancers.