Recombinant Human DnaJ homolog subfamily C member 18 (DNAJC18)

What is DNAJC18 and to which protein family does it belong?

DNAJC18 (DnaJ homolog subfamily C member 18) is a member of the type III DnaJ protein family, defined by the presence of a conserved J domain. Unlike type I DnaJ proteins, type III members like DNAJC18 possess the J domain but lack the glycine/phenylalanine-rich region and the cysteine-rich zinc finger domain that are characteristic of type I members . The J domain contains approximately 70 amino acid residues with a tripeptide histidine-proline-aspartic acid (HPD, J box) located between predicted helices II and III . DNAJC18 functions as a molecular cochaperone that must be recruited by Hsp70 for proper chaperone activity .

What is the molecular weight and sequence length of human DNAJC18?

Human DNAJC18 has a molecular weight of approximately 41.4 kDa . The full-length protein consists of 357-358 amino acid residues . In rat models, the DnaJC18 cDNA has been shown to have the longest open reading frame of 357 amino acids . The protein contains specific domains that contribute to its function as a molecular cochaperone in the DnaJ/Hsp40 family.

What is the tissue-specific expression pattern of DNAJC18?

Research using Northern blot analysis has demonstrated that DNAJC18 is expressed specifically in testis tissue . Developmental studies in rat models have shown that DNAJC18 expression begins at postnatal week 4 in testis . This highly tissue-specific expression pattern suggests a specialized role for DNAJC18 in testicular function, particularly in spermatogenesis.

At which cellular level is DNAJC18 expressed during spermatogenesis?

In situ hybridization studies have revealed that DNAJC18 mRNA is expressed only during specific maturation stages of spermatogenesis, including:

• Late pachytene spermatocytes

• Round spermatids

• Elongated spermatids

This expression pattern in adult rat testis indicates involvement in the later stages of germ cell development . Western blot analysis with DNAJC18 antibody has confirmed that the 41.2 kDa DNAJC18 protein is detected only in adult testis, and immunohistochemistry studies have further confirmed expression in developing germ cells .

What is the subcellular localization of DNAJC18 protein?

Confocal microscopy studies using GFP-tagged DNAJC18 protein have revealed that DNAJC18 is primarily localized in the cytoplasm of cells . This cytoplasmic localization is consistent with the role of many DnaJ family proteins as cytoplasmic molecular chaperones that assist in protein folding, transport, and quality control mechanisms.

What methods are most effective for detecting DNAJC18 expression at the mRNA level?

Based on published research methodologies, the following approaches have proven effective for detecting DNAJC18 expression at the mRNA level:

• Northern Blot Analysis: This technique has been successfully used to determine tissue-specific expression patterns and developmental timing of DNAJC18 expression .

• In Situ Hybridization: This method allows for precise localization of DNAJC18 mRNA within tissue sections, revealing expression in specific cell types during spermatogenesis .

• RT-PCR: While not explicitly mentioned in the search results, RT-PCR would be a sensitive method for detecting DNAJC18 mRNA expression, especially in tissues with low expression levels.

The choice of method depends on the specific research question, with Northern blotting providing information about transcript size and abundance, in situ hybridization offering spatial resolution, and RT-PCR providing high sensitivity.

What are the recommended approaches for detecting DNAJC18 at the protein level?

Several complementary approaches can be used to detect and analyze DNAJC18 protein:

• Western Blot Analysis: Using specific antibodies against DNAJC18, such as the anti-DNAJC18 mouse polyclonal antibody , researchers can detect the 41.2 kDa DNAJC18 protein in tissue extracts .

• Immunohistochemistry: This technique allows for the visualization of DNAJC18 protein expression in tissue sections, enabling the identification of specific cell types expressing the protein .

• Confocal Microscopy with GFP Fusion Proteins: By creating GFP-DNAJC18 fusion constructs and expressing them in cell lines (e.g., CVI kidney cells or GC2 germ cells), researchers can determine the subcellular localization of DNAJC18 .

For optimal results, a combination of these approaches is recommended to validate protein expression, localization, and potential interactions.

How can I clone the full-length DNAJC18 cDNA for expression studies?

The following methodology has been successfully employed for cloning full-length DNAJC18 cDNA:

• cDNA Library Screening: Using a known fragment of DNAJC18 as a probe (e.g., a 230 bp fragment), screen a testis cDNA library to identify full-length clones .

• PCR-Based Cloning:

  • Design primers that encompass the entire coding region of DNAJC18

  • Example forward primer with an EcoRI site: 5' TAGAATTCTATGGCGGCCACTCTGGGC 3'

  • Example reverse primer with a SalI site: 5' TAGTCGACTCAGCCGGCCCTGCGGAG 3'

  • Amplify the full-length coding sequence and clone into an appropriate expression vector

• Sequencing Verification: Confirm the integrity of the cloned sequence by DNA sequencing to ensure no mutations are present.

This approach allows for the generation of expression constructs for functional studies of DNAJC18.

What expression systems are suitable for producing recombinant DNAJC18 protein?

Based on the search results, several expression systems have been successfully used for DNAJC18 production:

• Mammalian Expression Systems:

  • HEK-293 cells have been used to produce recombinant mouse DNAJC18 protein with a His tag

  • This system provides proper post-translational modifications and folding

• Cell-Free Protein Synthesis (CFPS):

  • Has been utilized to produce DNAJC18 with Strep tags

  • Offers rapid production without the need for cell culture

• Wheat Germ Expression System:

  • Has been used for human DNAJC18 production

  • Known for producing properly folded proteins with high yield

The choice of expression system should be based on specific research needs, including required protein yield, purity, post-translational modifications, and downstream applications.

How can I generate and validate antibodies against DNAJC18 for research applications?

Based on published methodologies, the following approach has been successful for generating anti-DNAJC18 antibodies:

• Peptide Selection and Synthesis:

  • Select a unique peptide sequence from DNAJC18 (e.g., 20 amino acids corresponding to residues #325-#344: NH2-GLYRDERLRQKAESLKLENC-COOH)

  • Conjugate the peptide to a carrier protein like BSA

• Immunization Protocol:

  • Dissolve the BSA-conjugated peptide at 0.2 mg/mL in physiological saline

  • Emulsify with Freund's complete adjuvant for initial immunization and incomplete adjuvant for boosters

  • Immunize animals (e.g., New Zealand rabbits) four times at two-week intervals

• Antibody Purification and Validation:

  • Collect serum after three booster injections

  • Purify IgG using affinity purification methods (e.g., Melon Gel IgG purification)

  • Validate antibody specificity by Western blot using tissues known to express DNAJC18 (e.g., testis)

This methodological approach yields specific antibodies suitable for Western blotting and immunohistochemistry applications.

What strategies can be employed to investigate DNAJC18's functional interactions with other proteins?

Several methodological approaches can be used to study DNAJC18's protein-protein interactions:

• Co-Immunoprecipitation (Co-IP):

  • Use anti-DNAJC18 antibodies to pull down DNAJC18 along with its interacting partners

  • Identify binding partners through mass spectrometry analysis

• Yeast Two-Hybrid Screening:

  • Use DNAJC18 as bait to screen for interacting proteins from a cDNA library

  • Validate interactions through additional methods

• Proximity Labeling Techniques (BioID or APEX):

  • Fuse DNAJC18 to a biotin ligase or peroxidase

  • Express in cells to biotinylate proximal proteins

  • Purify biotinylated proteins and identify by mass spectrometry

• Fluorescence Resonance Energy Transfer (FRET):

  • Create fluorescently tagged DNAJC18 and potential interacting proteins

  • Measure energy transfer to detect proximity-based interactions

Since DNAJC18 is a type III DnaJ protein that likely functions as a cochaperone for Hsp70 chaperones , investigating its interactions with Hsp70 family members would be a logical starting point.

What are common challenges in expressing recombinant DNAJC18 and how can they be addressed?

Researchers may encounter several challenges when working with recombinant DNAJC18:

• Poor Expression Yield:

  • Solution: Optimize codon usage for the expression system

  • Try different expression systems (HEK-293 cells, CFPS, or wheat germ)

  • Adjust induction conditions (temperature, time, inducer concentration)

• Protein Solubility Issues:

  • Solution: Express as a fusion protein with solubility-enhancing tags (e.g., MBP, SUMO)

  • Optimize buffer conditions for extraction and purification

  • Consider expressing truncated versions containing functional domains

• Purification Challenges:

  • Solution: Use affinity tags like His or Strep tags for efficient purification

  • Implement multi-step purification strategies including ion exchange and size exclusion chromatography

  • Validate protein purity using SDS-PAGE, Western blot, and analytical SEC (HPLC)

• Protein Activity Verification:

  • Solution: Develop functional assays to verify proper folding and activity

  • Test interaction with known binding partners (e.g., Hsp70 family members)

When working with DNAJC18, researchers should expect purity levels of >70-90% as determined by various analytical methods including PAGE, Western blot, and HPLC .

How should contradictory results in DNAJC18 expression studies be interpreted?

When faced with contradictory results regarding DNAJC18 expression or function:

• Consider Species Differences:

  • Expression patterns may vary between species (e.g., mouse vs. human)

  • Compare results with published data for the specific species under investigation

• Evaluate Developmental Timing:

  • DNAJC18 expression is developmentally regulated, appearing at specific stages (e.g., postnatal week 4 in rat testis)

  • Ensure samples are collected at comparable developmental stages

• Assess Methodology Sensitivity:

  • Different detection methods have varying sensitivities

  • Western blotting may detect protein only in tissues with high expression

  • More sensitive techniques like RT-qPCR might detect low-level expression in additional tissues

• Verify Antibody Specificity:

  • Antibody cross-reactivity could lead to false positive results

  • Include appropriate positive and negative controls

  • Consider using multiple antibodies targeting different epitopes

• Examine Experimental Conditions:

  • Cell culture conditions, tissue preparation methods, and experimental procedures can affect results

  • Standardize protocols across experiments for consistency

By systematically addressing these factors, researchers can resolve apparent contradictions in experimental results.

What are promising approaches for elucidating the physiological role of DNAJC18 in spermatogenesis?

Based on current knowledge of DNAJC18's expression pattern in testis , several research approaches could help elucidate its physiological role:

• Conditional Knockout Models:

  • Generate testis-specific or germ cell-specific DNAJC18 knockout mice

  • Analyze effects on spermatogenesis, sperm maturation, and fertility

• Identification of Client Proteins:

  • Perform immunoprecipitation followed by mass spectrometry to identify proteins that interact with DNAJC18 in testicular cells

  • Characterize how DNAJC18 affects the folding, stability, or localization of these client proteins

• Transcriptomic and Proteomic Profiling:

  • Compare gene expression and protein profiles between wild-type and DNAJC18-deficient testicular cells

  • Identify pathways affected by DNAJC18 depletion

• Structure-Function Analysis:

  • Create mutant versions of DNAJC18 with alterations in key domains

  • Assess how these mutations affect interaction with Hsp70 chaperones and client proteins

• Developmental Expression Studies:

  • Perform detailed analysis of DNAJC18 expression during specific stages of spermatogenesis

  • Correlate expression with cellular events in germ cell maturation

These approaches would provide insights into DNAJC18's specific role in testicular function and potentially identify novel mechanisms in spermatogenesis.

What methodological advances would benefit DNAJC18 research?

Several methodological advances could significantly enhance DNAJC18 research:

• CRISPR/Cas9-Mediated Genome Editing:

  • Generate cell lines and animal models with precise modifications to DNAJC18

  • Create reporter knock-ins to monitor endogenous DNAJC18 expression

• Single-Cell Analysis Techniques:

  • Apply single-cell RNA-seq and proteomics to characterize DNAJC18 expression at unprecedented resolution

  • Identify cell populations that express DNAJC18 in heterogeneous tissues

• Advanced Imaging Approaches:

  • Implement super-resolution microscopy to visualize DNAJC18 subcellular localization with greater precision

  • Use live-cell imaging to monitor DNAJC18 dynamics during cellular processes

• Structural Biology Methods:

  • Determine the three-dimensional structure of DNAJC18 using cryo-EM or X-ray crystallography

  • Provide insights into the molecular basis of DNAJC18 function and interactions

• Systems Biology Approaches:

  • Integrate multi-omics data to place DNAJC18 within broader cellular networks

  • Model how DNAJC18 contributes to cellular homeostasis and specific physiological processes

These methodological advances would facilitate more comprehensive understanding of DNAJC18's biological roles and mechanisms of action.