Recombinant Human E3 ubiquitin-protein ligase RNF19B (RNF19B)

What is the molecular structure of RNF19B and how does it function as an E3 ubiquitin ligase?

RNF19B belongs to a 14-member group of E3 ubiquitin ligases characterized by a cysteine-rich RING-IBR-RING (RBR) domain that mediates substrate ubiquitination. The conserved catalytic cysteine (C302) in the RING2 domain is considered critical for its ligase activity . RNF19B functions through a three-step ubiquitination process involving E1 activating enzymes, E2 conjugating enzymes, and its own E3 ligase activity to coordinate the ligation of ubiquitin onto target proteins .

The RBR domain alone is capable of binding both substrates and ubiquitin conjugates. The consequence of substrate ubiquitination varies depending on the type of ubiquitin linkages formed, potentially leading to proteasome-mediated degradation or alterations in protein localization and function .

Which ubiquitin-conjugating enzymes (E2s) interact with RNF19B?

RNF19B demonstrates specificity in its E2 interactions. It has been shown to interact with the ubiquitin conjugating enzymes UbcH7 and UbcH8, but not with UbcH10 . Upon stimulation of NK cells with IFNβ, both RNF19B and UbcH8 are upregulated and can be co-immunoprecipitated. These ubiquitin conjugates bind to the RING domain of RNF19B .

UbcH7 is particularly noteworthy as it is unique in being strictly cysteine-reactive and works predominantly with RBR E3 ligases like RNF19B, while most E2-conjugating enzymes transfer ubiquitins onto both lysine and cysteine residues .

How is RNF19B expression regulated in different cell types?

RNF19B expression is dynamically regulated in immune cells. In macrophage cell lines (RAW 264.7 and J774), peak RNF19B expression is observed 16 hours after stimulation with various treatments including LPS, IFNγ, and bacterial pathogens such as Escherichia coli or Staphylococcus aureus . The combination of LPS plus IFNγ leads to the largest increase in RNF19B levels .

Poly (I:C), a mimetic of double-stranded RNA and a TLR3 agonist, also induces RNF19B expression in bone marrow-derived macrophages . The NKLAM promoter contains binding sites for transcription factors including NFκB proteins p50 and p65/RelA, as well as IRF-1 and IRF-2, suggesting multiple regulatory pathways for RNF19B expression .

What methods are recommended for detecting RNF19B expression in experimental systems?

For quantitative mRNA detection, researchers can use the following primer sequences:

• Human RNF19B forward primer: CGGACTGCGGTTATGCTGTTA

• Human RNF19B reverse primer: CGCATGTCTGATTTGGATGCC

• Mouse RNF19B forward primer: GGGAGGGCTGCCAGACTGAG

• Mouse RNF19B reverse primer: CCTGAAGTGTGCTTGGTCCGAAC

For protein detection, western blot analysis can be performed using whole-cell lysates obtained from cells scraped in RIPA buffer, followed by SDS-PAGE, transfer to PVDF membranes, and incubation with specific RNF19B antibodies .

For tissue samples, immunohistochemistry can be performed on paraffin sections following dewaxing and antigen retrieval using the microwave heating method in AR6 buffer .

What approaches can be used to identify RNF19B substrates and binding partners?

The yeast two-hybrid system has proven effective for identifying potential substrate proteins that bind to and are ubiquitinated by RNF19B. This approach uses the RING domain of RNF19B as bait to trap binding proteins from cDNA libraries . Using this methodology, uridine-cytidine kinase-like 1 (UCKL-1, previously called URKL-1) was identified as interacting with RNF19B .

Co-transfection studies in cell lines such as HEK293 can confirm protein interactions, leading to subsequent analysis of ubiquitination and degradation of potential substrates. Researchers can design NKLAM constructs containing one or more of the RING domains to analyze their ability to bind substrates and ubiquitin conjugates .

What methods are effective for manipulating RNF19B expression in cellular models?

For knockdown experiments, RNF19B shRNA can be synthesized with target sequences such as CGAGGGACAAACTGTCTTGAA . Alternatively, siRNA transfection can be performed using sequences like:

• RNF19B siRNA: GCAAUUAGCGACAGCGCAATT, UUGCGCUGUCGCUAAUUGCTT

• Control siRNA: UUCUCCGAACGUGUCACGUTT, ACGUGACACGUUCGGAGAATT

For transfection, cells should be plated and cultured overnight to achieve appropriate confluency. The shRNA/siRNA and transfection reagent (such as Lipofectamine 2000) can be individually diluted in serum-free medium, combined to create a transfection mixture, and incubated for approximately 25 minutes before adding to cells .

How can co-culture systems be established to study RNF19B's role in cell-cell interactions?

Cross-talk between cancer cells and macrophages can be studied using a co-culture model with cell culture inserts containing 0.4 μm pores. In this system, macrophages and hepatocellular carcinoma (HCC) cells can be cultivated in the bottom and above inserts, respectively, for 48 hours before collection for subsequent assays .

For macrophage induction from monocytes, THP-1 cells can be treated with 50 ng/mL of phorbol-12-myristate-13-acetate for 1 day, followed by culture in fresh medium without the stimulant for 2 additional days .

What is the clinical significance of RNF19B expression in hepatocellular carcinoma?

Table 1: Univariate and Multivariate Cox Regression Analysis of RNF19B Expression in HCC Patients

What statistical approaches are recommended for analyzing RNF19B's prognostic value?

For robust statistical analysis of RNF19B's prognostic value, feature selections can be performed using the R "glmnet" package based on significant prognostic genes determined through the minor absolute shrinkage and selection operator method . Multivariate Cox regression should be performed to identify significant markers for building a risk model.

Patients can be categorized into high or low-risk groups based on determined median values of RNF19B expression. Receiver-operating characteristic curves and area under the curve (AUC) analysis can evaluate the prognostic accuracy using packages such as "risk regression," "timeROC," and "survivor" . Significant predictors can be incorporated to construct a nomogram, which can then be calibrated using the calibration curve with R "rms" and "survival" packages .

How can RNF19B be targeted for therapeutic applications?

Recent research has developed a nanobody (VHH)-based degradation toolbox termed REULR (Receptor Elimination by E3 Ubiquitin Ligase Recruitment) that targets transmembrane PA-TM-RING-type E3 ubiquitin ligases, a category that includes RNF19B . This approach generates human and mouse cross-reactive nanobodies against several E3 ubiquitin ligases with varying tissue expression patterns .

Heterobifunctional REULR molecules can enforce transmembrane E3 ligase interactions with disease-relevant target receptors (such as EGFR, EPOR, and PD-1) through induced proximity, resulting in effective membrane clearance of the target receptor . Additionally, "fratricide" REULRs can be designed to allow downregulation of one or several E3 ligases from the cell surface, consequently modulating receptor signaling strength .

What are the key considerations for developing recombinant RNF19B for research applications?

When developing recombinant RNF19B for research applications, several factors should be considered:

• Domain selection: The entire RBR domain, without the N-terminal and C-terminal regions of NKLAM, is capable of binding substrates and ubiquitin conjugates . This knowledge can guide the design of functional recombinant constructs.

• E2 selection: Since RNF19B shows specificity for UbcH7 and UbcH8 , these E2 enzymes should be considered for in vitro ubiquitination assays involving recombinant RNF19B.

• Buffer conditions: Appropriate buffer conditions must be established to maintain the structural integrity and catalytic activity of the RBR domain, particularly preserving the function of the critical catalytic cysteine (C302) .

• Activity verification: Functional assays should be employed to confirm that the recombinant RNF19B retains its E3 ubiquitin ligase activity, possibly using known substrates like UCKL-1 .