Recombinant Human Frizzled-5 (FZD5)

What is the molecular structure and basic characteristics of Recombinant Human Frizzled-5?

Frizzled-5 is an approximately 62 kDa 7-transmembrane (7-TM) glycoprotein that functions as a receptor for Wnt proteins and other ligands. The mature human FZD5 structure consists of a 212 amino acid extracellular domain (ECD), a 283 amino acid 7-TM region, and a 64 amino acid cytoplasmic domain containing a PDZ binding motif . The ECD includes a cysteine-rich region (CRD) that is highly conserved among Frizzled proteins and serves as the primary binding site for Wnt ligands . Within the N-terminal ECD, human FZD5 shares 95% amino acid sequence identity with mouse and rat FZD5, indicating strong evolutionary conservation .

Recent structural studies using single-particle cryo-electron microscopy have determined the structure of unliganded human FZD5 at 3.7 Å resolution with the aid of an antibody chaperone acting as a fiducial marker . This structural information provides crucial insights into the receptor's native conformation and potential activation mechanisms.

What ligands are known to bind to FZD5 and how do they function in signaling pathways?

FZD5 serves as a receptor for multiple ligands that trigger distinct signaling cascades:

Wnt Proteins:

• Wnt-5a

• Wnt-9b

• Wnt-10b

• Wnt-2b

• Wnt-7a

Other Ligands:

• Secreted Frizzled-Related Protein 2 (SFRP2)

In canonical Wnt signaling, FZD5 interacts with Wnt ligands alongside low-density lipoprotein receptor-related proteins LRP-5 or LRP-6 as co-receptors, which stabilizes β-catenin and promotes gene transcription essential for development and tissue maintenance . FZD5 can also signal through non-canonical pathways independently of LRPs . For example, when SFRP2 binds to FZD5, it modulates angiogenesis via the calcineurin-dependent Nuclear Factor of Activated T-cells cytoplasmic 3 (NFATc3) pathway in endothelial cells .

Experimental comparisons between Wnt3a and a "surrogate agonist" that cross-links FZD to LRP6 have revealed identical structure-activity relationships, suggesting common activation mechanisms despite different binding modes .

How is recombinant FZD5 typically formulated for research applications?

Commercial recombinant human FZD5 is often produced as an Fc chimera protein with specific formulation characteristics:

Recombinant FZD5 is available in both carrier-containing and carrier-free (CF) formulations. The standard formulation typically includes Bovine Serum Albumin (BSA) as a carrier protein to enhance stability, increase shelf-life, and allow storage at more dilute concentrations . The carrier-free version does not contain BSA and is recommended for applications where BSA might interfere with experimental outcomes .

For cell or tissue culture applications and ELISA standards, the BSA-containing version is generally recommended, while the carrier-free protein is preferred for applications where BSA could cause experimental interference .

What techniques can be employed to study FZD5-ligand binding interactions?

Several sophisticated techniques provide insights into FZD5-ligand interactions with varying levels of resolution:

ELISA Binding Assays:
Researchers can quantitatively measure binding affinity between FZD5 and its ligands using enzyme-linked immunosorbent assays. A validated protocol for measuring SFRP2-FZD5 binding involves:

• Coating Ni²⁺-coated 96-well microplates and blocking with 0.05% BSA in PBS

• Incubating his-tagged recombinant ligand (e.g., rhSFRP2) at concentrations ranging from 24-1500 nM

• Adding FZD5-Fc fusion protein (100 nM)

• Detecting binding through appropriate antibody-based systems

This approach allows determination of binding EC₅₀ values for comparative analysis between different ligands such as SFRP2 and Wnt5a .

Structural Analysis Methods:
Cryo-electron microscopy has successfully determined the structure of unliganded human FZD5 at 3.7 Å resolution . Analysis of Wnt/FZD5 complex particles has revealed extreme flexibility between the Wnt/FZD-CRD and the FZD-TM regions, which complicates efforts to resolve high-resolution structures of stable binary Wnt/FZD complexes .

Co-immunoprecipitation and Co-immunofluorescence:
These complementary techniques can verify protein-protein interactions and visualize co-localization of FZD5 with binding partners in cellular contexts .

Molecular Modeling:
Amino acid alignments and molecular modeling have been used to demonstrate that SFRP2 interaction with FZD5 follows patterns typical of Wnt/FZD family members .

What strategies are effective for modulating FZD5 expression in experimental models?

Researchers have developed multiple approaches for both knockdown and overexpression of FZD5:

FZD5 Knockdown via shRNA:

• Cell plating (1×10⁴ cells/well) and overnight incubation

• Transfection mixture preparation:

  • 1 μg shRNA plasmid in 500 μl Opti-MEM medium

  • 5 μl PLUS™ reagent (incubated 5 minutes at RT)

  • 15 μl Lipofectamine® reagent (incubated 30 minutes at RT)

• Addition of 500 μl SOC solution dropwise to cells

• Incubation at 37°C for 48 hours

• Selection with puromycin (3 μg/ml) with media changes every 2-3 days

• Validation of knockdown via Western blot analysis

An example effective shRNA sequence targeting FZD5: TTCCTTCTGGCAGGCTTCGTGTCACTCTT

FZD5 Overexpression via Lentiviral Transduction:

• Cell plating (1×10⁴ cells/well) and overnight incubation

• Medium replacement with complete medium containing:

  • Polybrene (8 μg/mL)

  • ViralPlus Transduction Enhancer G698 (1:100)

  • FZD5/GFP lentivirus

• Overnight incubation followed by medium replacement

• Selection with puromycin (2 μg/ml) after 24 hours

• Verification of expression by Western blot and fluorescence microscopy

For functional assays, puromycin should be removed from the medium at least two days prior to initiating experiments to eliminate potential confounding effects .

How can researchers assess functional activity of FZD5 in cellular models?

Multiple functional assays can evaluate FZD5 activity in different experimental contexts:

Angiogenesis Assessment:

• Tube Formation Assays: Measure the ability of endothelial cells to form capillary-like structures on basement membrane matrix. Studies have demonstrated that FZD5 is necessary for SFRP2-induced tube formation in endothelial cells .

Signaling Pathway Activation:

• Intracellular Calcium Flux: Measure changes in intracellular calcium concentration using fluorescent calcium indicators. FZD5 has been shown to be necessary for SFRP2-induced intracellular calcium flux in endothelial cells .

• β-catenin Stabilization Assays: Assess canonical Wnt pathway activation through measurement of β-catenin levels, nuclear translocation, or reporter gene assays (TOPFlash/FOPFlash) .

Cell Migration:

• Migration assays can determine the functional consequences of FZD5 activation in relevant cell types .

Structure-Function Analyses:
The FZD5-TM structure determined by cryo-EM has guided the design of mutations to explore the role of transmembrane coupling in signaling by both Wnt ligands and surrogate agonists . Similar mutation-based approaches can be employed to investigate specific functional domains of the receptor.

What structural insights have been gained from recent cryo-EM studies of FZD5?

Recent structural biology advances have provided unprecedented insights into FZD5:

The structure of unliganded human FZD5 has been determined by single-particle cryo-EM at 3.7 Å resolution, using an antibody chaperone as a fiducial marker . This represents a significant technical achievement as the structure was determined without thermostabilizing mutations, providing a more native view of the receptor's conformation .

Analysis of Wnt/FZD5 complex particles revealed extreme flexibility between the Wnt/FZD-CRD and the FZD-TM regions, which has complicated efforts to resolve a high-resolution structure of a stable binary Wnt/FZD complex . Despite this challenge, important insights into the topology of the complex have been obtained.

The FZD5-TM structure has guided the design of mutations to explore the role of transmembrane coupling in signaling . Intriguingly, identical structure-activity relationships were observed when comparing natural Wnt3a signaling versus a "surrogate agonist" that cross-links FZD to LRP6, suggesting common activation mechanisms despite different binding modalities .

These structural studies provide a foundation for rational design of therapeutics targeting FZD5 and for deeper understanding of its activation mechanisms.

How does SFRP2 binding to FZD5 differ from Wnt protein binding in terms of binding mechanisms and downstream effects?

SFRP2 and Wnt proteins interact with FZD5 in distinct ways leading to different functional outcomes:

Binding Mechanisms:
Amino acid alignments and molecular modeling demonstrate that SFRP2 interaction with FZD5 follows patterns typical of Wnt/FZD family members, despite SFRP2 not being a classical Wnt protein . Both SFRP2 and Wnt proteins target the cysteine-rich domain (CRD) of FZD5, though potentially with different binding affinities and kinetics that can be measured through ELISA-based binding assays .

Downstream Signaling Pathways:

• SFRP2-FZD5 Signaling: Primarily activates the calcineurin-dependent NFATc3 pathway in endothelial cells, leading to pro-angiogenic effects .

• Wnt-FZD5 Signaling: Can activate both canonical (β-catenin-dependent) and non-canonical pathways, depending on the specific Wnt ligand and cellular context .

Functional Consequences:

• SFRP2 through FZD5 promotes angiogenesis, including tube formation and intracellular calcium flux in endothelial cells .

• Different Wnt proteins binding to FZD5 have varied biological effects, including roles in vascular development, neuronal polarity establishment, eye development, and inflammatory responses in immune cells .

Understanding these differences is crucial for designing targeted interventions and for interpreting experimental results involving FZD5 modulation.

What is known about the expression and role of FZD5 in specific physiological and pathological contexts?

FZD5 demonstrates context-specific expression and function across multiple biological systems:

Developmental Expression:
FZD5 is expressed in numerous embryonic tissues, including the telencephalon, pituitary, thalamus, hypothalamus, eye, liver, spleen, lung, and kidney . This broad expression pattern underscores its fundamental role in organogenesis.

Neural Development and Function:

• Mediates the synaptogenic effect of Wnt-7a

• Contributes to the development of neuronal polarity

• Required for neuronal survival in the thalamus

Vascular Biology:

• Maintains yolk sac and placental vasculature

• Contributes to regression of vitreous vasculature during eye development

• SFRP2 binding to FZD5 promotes angiogenesis in endothelial cells

Immune System:
In macrophages and monocytes, FZD5 signaling induces production of inflammatory cytokines, suggesting its role in immune regulation and potentially in inflammatory disorders .

Adult Tissue Expression:
FZD5 maintains expression in adult retina, colon, and pancreatic islets, indicating continued physiological functions beyond development .

Pathological Contexts:

• Expressed in some cancer cell lines, suggesting potential roles in tumorigenesis

• SFRP2, a FZD5 ligand, is a pro-angiogenic factor expressed in the vasculature of various human tumors

• Implicated in growth-factor-driven resistance to anticancer kinase inhibitors

How can researchers distinguish between canonical and non-canonical Wnt signaling through FZD5?

Differentiating between canonical and non-canonical signaling downstream of FZD5 requires specific experimental approaches:

Pathway-Specific Readouts:

Co-receptor Involvement:

• Canonical Wnt signaling through FZD5 requires LRP5/6 co-receptors

• Non-canonical pathways function independently of LRPs

• Using a "surrogate agonist" that specifically cross-links FZD to LRP6 can selectively activate the canonical pathway

Pharmacological Approach:
Selective pathway inhibitors can help distinguish active signaling modes:

• XAV939: Inhibits canonical Wnt signaling by targeting tankyrase

• NSC668036: Disrupts Dishevelled PDZ domain

• Cyclosporine A: Inhibits calcineurin in the calcium/NFAT pathway

Genetic Approach: Knockdown or knockout of pathway-specific components can reveal which pathway is being activated downstream of FZD5 in response to specific ligands.