Recombinant Human GRAM domain-containing protein 1A (GRAMD1A)

What is the domain architecture of GRAMD1A and how does it relate to its function?

GRAMD1A contains three key structural elements: a transmembrane region that anchors it to the endoplasmic reticulum (ER), a GRAM domain that can bind phosphatidylinositol phosphate at the plasma membrane (PM), and a VASt domain capable of binding cholesterol. The protein belongs to the yeast lipid transfer proteins anchored at membrane contact sites (LAM) family .

The domain organization directly relates to its function: the GRAM domain serves as a coincidence detector of unsequestered/accessible cholesterol and anionic lipids in the PM, particularly phosphatidylserine, allowing GRAMD1A to sense expansion of the accessible pool of PM cholesterol. Meanwhile, the VASt domain enables cholesterol binding and facilitates its transport from the PM to the ER .

How does GRAMD1A participate in cellular cholesterol homeostasis?

GRAMD1A plays a critical role in maintaining PM cholesterol homeostasis through a two-step process:

• Sensing function: When PM cholesterol levels rise above a certain threshold, the GRAM domain of GRAMD1A detects this expansion in the accessible cholesterol pool. This sensing mechanism involves interaction with anionic lipids at the PM, particularly phosphatidylserine .

• Transport function: Following detection, GRAMD1A moves to ER-PM contact sites and, through its StART-like (VASt) domain, facilitates the transport of accessible PM cholesterol to the ER. This transport helps maintain appropriate cholesterol levels and distribution across cellular membranes .

In cells lacking GRAMD1 proteins (GRAMD1a/1b/1c triple knockout), researchers have observed striking expansion of the accessible pool of PM cholesterol, demonstrating less efficient PM-to-ER transport of accessible cholesterol .

What is the relationship between GRAMD1A and other GRAMD family proteins?

GRAMD1A has four paralogs: GRAMD1B and GRAMD1C (which also contain VASt domains) and GRAMD2A and GRAMD2B (which lack VASt domains) . These proteins form a family with distinct localization patterns and functions:

• GRAMD1A, GRAMD1B, and GRAMD1C all participate in cholesterol transport from the PM to the ER, with some functional redundancy

• GRAMD2A pre-marks sites of STIM1 localization at ER-PM contacts and is required for normal STIM1 recruitment during store-operated calcium entry (SOCE)

• GRAMD1A and GRAMD2A localize to physically distinct ER-PM domains with discrete functional roles

Gene set enrichment analysis (GSEA) has shown that GRAMD1A and GRAMD2A exhibit diverse correlated pathways, with GRAMD2A showing positive correlations with genes involved in lipid metabolism, while GRAMD1A shows opposite correlation patterns .

What are the recommended approaches for detecting and quantifying GRAMD1A expression in different tissue samples?

Multiple complementary approaches are recommended for comprehensive GRAMD1A detection and quantification:

• RNA-level detection:

  • Quantitative polymerase chain reaction (qPCR): Extract total RNA using Trizol reagent, perform reverse transcription with a cDNA synthesis kit, and utilize SYBR real-time PCR with GRAMD1A-specific primers. The 2-ΔΔCt method is suitable for relative quantification .

  • Recommended primers: Forward: GATGCTCTCTTCTCGGACTCG, Reverse: GATGGGGATGGTGTACGTC (with β-actin as reference gene) .

• Protein-level detection:

  • Western blotting: Particularly effective for confirming knockout models and analyzing relative protein levels .

  • Immunohistochemistry: Useful for visualizing tissue distribution and subcellular localization.

  • Monoclonal antibodies: Several have been developed specifically against GRAMD1A, enabling detection in various tissues and tumor cell lines .

• Publicly available resources:

  • The Human Protein Atlas (HPA) database provides tissue expression data for GRAMD1A .

  • UALCAN database offers protein-level expression analysis across various cancers .

For experimental validation, it's advisable to use multiple detection methods and include appropriate controls, particularly when studying expression in cancer versus normal tissues.

What are the most effective methods for studying GRAMD1A-mediated cholesterol transport?

Several complementary approaches have proven effective for studying GRAMD1A-mediated cholesterol transport:

• Live-cell imaging with cholesterol-sensing probes:

  • The EGFP-D4H probe is particularly valuable for visualizing the accessible pool of PM cholesterol in real-time. Increased binding of this probe to the PM indicates expansion of the accessible cholesterol pool .

  • This approach can be combined with manipulations of GRAMD1A expression or function to observe effects on cholesterol distribution.

• Sphingomyelinase (SMase) treatment:

  • SMase treatment acutely liberates sphingomyelin-sequestered PM cholesterol into the accessible pool, stimulating its PM-to-ER transport.

  • This creates a useful experimental model for studying GRAMD1A recruitment to ER-PM contacts and subsequent cholesterol transport .

• Forced recruitment assays:

  • Rapamycin-induced dimerization systems can be used to artificially recruit GRAMD1 proteins to ER-PM contacts.

  • For example, cells can be co-transfected with a modified GRAMD1b where the N-terminus is replaced by a miRFP-tagged FKBP module, along with a PM-targeted FRB module. Rapamycin treatment then induces recruitment to the PM .

• GRAMD1 knockout and rescue experiments:

  • CRISPR/Cas9-generated GRAMD1 knockout cells (single, double, or triple) enable assessment of specific contributions of each family member.

  • Re-expression of wild-type or mutant GRAMD1 proteins in these knockout backgrounds allows functional domain analysis .

• Lipidomic analysis:

  • Mass spectrometry-based lipidomics of membrane extracts provides quantitative assessment of cholesterol and other lipid changes in response to GRAMD1 manipulation .

How can researchers generate and validate GRAMD1A knockout cell lines for functional studies?

Based on published methodologies, here is a comprehensive approach for generating and validating GRAMD1A knockout cell lines:

• CRISPR/Cas9-based knockout strategy:

  • Design guide RNAs targeting critical exons, particularly those encoding functional domains like the StART-like domain (e.g., exon 13 of GRAMD1A has been successfully targeted) .

  • Transfect cells with plasmids expressing GRAMD1A-specific guide RNAs and Cas9 protein.

  • Isolate single cell clones and expand for screening.

• Validation methods (multiple approaches should be used):

  • Genomic sequencing: PCR-amplify the targeted genomic region and sequence to confirm indel mutations resulting in frameshifts or premature stop codons .

  • Western blotting: Confirm absence of GRAMD1A protein using validated antibodies .

  • RT-qPCR: Verify reduction in mRNA expression or altered transcripts.

  • Functional assays: Demonstrate altered cholesterol dynamics using probes like EGFP-D4H, which should show increased binding to PM in GRAMD1A knockout cells due to expanded accessible cholesterol pools .

• Control considerations:

  • Generate multiple independent knockout clones to control for off-target effects.

  • Create rescue cell lines by re-expressing GRAMD1A to confirm phenotypes are specifically due to GRAMD1A loss.

  • For comprehensive functional analysis, consider generating double (GRAMD1A/1B) or triple (GRAMD1A/1B/1C) knockout cells to address potential compensation by other family members .

• Potential challenges:

  • Knockout cells may exhibit slightly slower growth than parental cells, requiring optimization of culture conditions .

  • Complete loss of all GRAMD1 proteins might affect multiple cellular processes due to their roles in cholesterol homeostasis.

How has GRAMD1A been implicated as a prognostic biomarker in different cancer types?

GRAMD1A has emerged as a significant prognostic biomarker across multiple cancer types, with particularly strong evidence in hepatocellular carcinoma (HCC) and kidney renal clear cell carcinoma (KIRC):

These findings suggest GRAMD1A could serve as a valuable biomarker for cancer diagnosis, prognosis, and potentially as a therapeutic target.

What methodological approaches reveal GRAMD1A's role in cancer stem cell maintenance and chemoresistance?

Research has demonstrated GRAMD1A's involvement in cancer stem cell maintenance and chemoresistance, particularly in hepatocellular carcinoma (HCC). Key methodological approaches include:

• Hepatosphere formation assay:

  • This technique assesses cancer stem cell self-renewal capacity by measuring the ability of cells to form spheroids in non-adherent conditions.

  • GRAMD1A overexpression increases hepatosphere formation, while GRAMD1A knockdown reduces it, indicating its role in maintaining cancer stem cell properties .

• Side population (SP) analysis:

  • Flow cytometry-based side population analysis identifies stem cell-like cancer cells through their ability to efflux Hoechst dye.

  • This approach has demonstrated GRAMD1A's contribution to the maintenance of cancer stem cell populations .

• Chemotherapy resistance assays:

  • TUNEL assay for measuring apoptosis following chemotherapy treatment shows that GRAMD1A expression levels correlate with resistance to chemotherapy-induced cell death.

  • Cells with high GRAMD1A expression exhibit reduced apoptosis following chemotherapy treatment .

• Soft agar growth ability assay:

  • This anchorage-independent growth assay measures the tumorigenic potential of cancer cells.

  • GRAMD1A overexpression enhances growth in soft agar, indicating increased tumorigenic potential .

• In vivo tumor growth models:

  • Xenograft models using cells with modified GRAMD1A expression demonstrate its impact on tumor initiation and growth.

  • These models confirm findings from in vitro studies regarding GRAMD1A's role in cancer progression .

How does GRAMD1A expression correlate with immune parameters in the tumor microenvironment?

GRAMD1A expression shows significant correlations with several immune parameters in the tumor microenvironment, particularly in kidney renal clear cell carcinoma (KIRC):

• Correlation with immune checkpoint genes:

  • Strong positive correlations exist between GRAMD1A expression and multiple immune checkpoint genes in KIRC, including TGFB1, PVRL2, LGALS9, CD276, TNFRSF4, TNFRSF8, TNFRSF18, and TNFRSF25.

  • These correlations have been validated across multiple databases (TISIDB and TIMER) .

• Association with tumor-infiltrating lymphocytes (TILs):

  • CIBERSORT algorithm analysis reveals that GRAMD1A expression positively correlates with neutrophils, naive B cells, and plasma cells.

  • Negative correlations are observed with gamma delta T cells and eosinophils .

• Impact on survival based on immune cell infiltration:

  • Kaplan-Meier plotter analysis demonstrates that the hazard ratio (HR) of death in KIRC patients with high GRAMD1A expression varies depending on the immune cell composition:

    • Lower HR when B lymphocytes, natural killer T cells, CD4+ T lymphocytes, CD8+ T lymphocytes, and macrophages are enriched

    • Higher HR when regulatory T lymphocytes (which have immunosuppressive effects) are significantly enriched .

• Correlation with immunotherapy response markers:

  • Spearman correlation analysis shows a positive correlation between GRAMD1A expression and microsatellite instability (MSI) and tumor mutational burden (TMB) (p < 0.01) .

  • These parameters are important biomarkers for predicting response to immune checkpoint inhibitor therapy.

These findings suggest that GRAMD1A may influence tumor progression partly through modulating the immune microenvironment, with potential implications for immunotherapy response.

How can researchers distinguish between the functional contributions of different GRAMD family proteins in cholesterol transport?

Distinguishing between the functional contributions of different GRAMD family proteins requires specialized experimental approaches:

• Generation of single, double, and triple knockout models:

  • CRISPR/Cas9-mediated knockout of individual GRAMD genes (GRAMD1A, GRAMD1B, GRAMD1C) and combinations allows assessment of unique and redundant functions.

  • Triple knockout cells (GRAMD1A/1B/1C TKO) exhibit more pronounced phenotypes in cholesterol transport than single knockouts, indicating functional redundancy .

• Domain swap experiments:

  • Creating chimeric proteins by swapping domains between GRAMD family members helps identify domain-specific functions.

  • For example, replacing the GRAM domain of one family member with that of another can determine if functional differences are due to sensing or transport capabilities .

• Acute recruitment assays with domain mutations:

  • Using rapamycin-induced dimerization systems to recruit specific GRAMD proteins (or mutated versions) to ER-PM contacts.

  • This approach can test which domains are necessary and sufficient for cholesterol transport .

• Tissue-specific expression analysis:

  • Gene set enrichment analysis (GSEA) using expression levels of GRAMD genes as input phenotypes reveals distinct co-expression patterns.

  • For example, GRAMD1A and GRAMD2A exhibit diverse correlated pathways, with GRAMD2A positively correlating with lipid metabolism genes while GRAMD1A shows opposite patterns .

• Super-resolution microscopy:

  • High-resolution imaging techniques can visualize the distinct localization patterns of different GRAMD proteins at ER-PM contacts.

  • This approach has revealed that GRAMD1A and GRAMD2A localize to physically separate ER-PM domains, suggesting distinct functions .

• Lipidomic profiling:

  • Comprehensive lipidomic analysis of membrane fractions from cells lacking specific GRAMD proteins can reveal distinct impacts on lipid composition.

What are the methodological considerations for studying GRAMD1A interactions with the STAT5 signaling pathway in cancer models?

Studying GRAMD1A interactions with the STAT5 signaling pathway requires careful methodological approaches, particularly in cancer models:

• Protein-protein interaction studies:

  • Co-immunoprecipitation (Co-IP): To detect physical interactions between GRAMD1A and STAT5 proteins in native conditions.

  • Proximity ligation assay (PLA): Visualizes protein interactions in situ with high sensitivity and specificity.

  • FRET/BRET analysis: For real-time monitoring of protein-protein interactions in living cells.

• Transcriptional regulation assessment:

  • Luciferase reporter assays: Using STAT5-responsive promoter elements to measure STAT5 transcriptional activity when GRAMD1A levels are modulated.

  • ChIP-seq analysis: To determine if GRAMD1A affects STAT5 binding to target gene promoters.

  • RNA-seq: To comprehensively analyze how GRAMD1A expression affects STAT5 target gene expression .

• Signaling pathway validation:

  • STAT5 inhibition in GRAMD1A-overexpressing cells: Studies have shown that inhibition of STAT5 in HCC cells overexpressing GRAMD1A suppresses the effects of GRAMD1A on cancer stem cell self-renewal, chemotherapy resistance, and tumor growth .

  • Phosphorylation analysis: Western blotting with phospho-specific antibodies to monitor STAT5 activation status.

• Functional rescue experiments:

  • Express constitutively active STAT5 in GRAMD1A-knockdown cells to determine if STAT5 activation can rescue the phenotype.

  • Express dominant-negative STAT5 in GRAMD1A-overexpressing cells to confirm STAT5 dependency.

• In vivo validation:

  • Xenograft models: Compare tumor growth with manipulation of both GRAMD1A and STAT5 activity.

  • Patient sample analysis: Correlate GRAMD1A expression with STAT5 activation markers in patient tumors.

Evidence suggests that GRAMD1A regulates the target genes of STAT5 and the transcriptional activity of STAT5, with inhibition of STAT5 suppressing the effects of GRAMD1A on cancer progression .

What advanced approaches can be used to investigate GRAMD1A's role in autophagosome biogenesis?

Investigating GRAMD1A's role in autophagosome biogenesis requires sophisticated experimental approaches:

• Live-cell imaging of autophagosome formation:

  • Fluorescently-tagged autophagy markers: Track LC3 (using GFP-LC3 or mCherry-GFP-LC3 for flux analysis), ATG proteins, and other autophagosome-associated proteins in GRAMD1A knockout or overexpressing cells.

  • Time-lapse microscopy: Monitor the kinetics of autophagosome formation and maturation in real-time.

  • Super-resolution microscopy: Visualize the spatial relationship between GRAMD1A and forming autophagosomes at nanometer resolution.

• Biochemical assessment of autophagy:

  • LC3 conversion assay: Measure LC3-I to LC3-II conversion by western blotting with and without lysosomal inhibitors.

  • p62/SQSTM1 degradation: Monitor levels of this autophagy substrate to assess autophagic flux.

  • Autophagic cargo degradation assays: Measure long-lived protein degradation rates.

• Membrane contact site analysis:

  • Electron microscopy: Visualize ER-autophagosome contacts and membrane remodeling events.

  • Proximity analysis: Use split fluorescent proteins or FRET-based sensors to detect GRAMD1A interactions with autophagy machinery.

  • Membrane fractionation: Isolate autophagosome precursors and analyze GRAMD1A content.

• Lipid transfer studies in autophagosome formation:

  • Lipid sensors: Deploy fluorescent lipid sensors to track cholesterol and phospholipid movements during autophagosome biogenesis.

  • In vitro reconstitution: Purify GRAMD1A protein domains to test direct lipid transfer capabilities to autophagosome-like liposomes.

• Genetic interaction mapping:

  • CRISPR screens: Identify genetic interactions between GRAMD1A and autophagy genes using CRISPR-based screens.

  • Epistasis analysis: Determine if GRAMD1A functions upstream, downstream, or parallel to known autophagy regulators.

• Domain-specific contributions:

  • Structure-function analysis: Generate GRAMD1A mutants with altered GRAM or VASt domains to determine which are required for its role in autophagy.

  • Acute recruitment assays: Use inducible systems to target specific GRAMD1A domains to autophagic membranes.

The involvement of GRAMD1A in autophagosome biogenesis likely connects to its role in membrane contact sites and lipid transport, providing a fascinating area for investigation of how lipid dynamics influence autophagy.

How should researchers interpret conflicting data regarding GRAMD1A expression patterns in different tissue types?

When encountering conflicting data about GRAMD1A expression patterns across tissue types, researchers should consider several factors for proper interpretation:

The current literature indicates that GRAMD1A is expressed ubiquitously with higher levels in the central nervous system , while showing significant upregulation in certain cancer types including HCC and KIRC .

What experimental challenges may arise when studying the role of GRAMD1A at membrane contact sites?

Studying GRAMD1A at membrane contact sites presents several experimental challenges that researchers should anticipate and address:

• Visualizing dynamic membrane contacts:

  • Challenge: ER-PM contact sites are dynamic and often transient, making them difficult to capture.

  • Solutions:

    • Use live-cell super-resolution microscopy with high temporal resolution

    • Apply techniques like TIRF microscopy to focus on PM-adjacent structures

    • Employ split fluorescent protein approaches to visualize only proteins at contact sites

• Distinguishing between different contact site proteins:

  • Challenge: Multiple proteins populate ER-PM contacts, making it difficult to isolate GRAMD1A-specific functions.

  • Solutions:

    • Use GRAMD1A knockout cells complemented with domain mutants

    • Apply acute recruitment strategies to specifically manipulate GRAMD1A localization

    • Use proximity labeling methods (BioID, APEX) to identify GRAMD1A-specific interactors at contact sites

• Measuring lipid transport activities:

  • Challenge: Quantifying cholesterol movement between membranes in living cells is technically demanding.

  • Solutions:

    • Deploy fluorescent cholesterol sensors that don't disrupt membrane properties

    • Use acute treatments like sphingomyelinase to trigger measurable cholesterol redistribution

    • Implement lipidomic approaches to quantify changes in membrane composition

• Functional redundancy among GRAMD proteins:

  • Challenge: GRAMD1A, GRAMD1B, and GRAMD1C have overlapping functions, masking phenotypes in single knockouts.

  • Solutions:

    • Generate double and triple knockout cell lines

    • Use acute protein degradation systems for temporal control

    • Apply domain-specific inhibitors if available

• Reconstituting membrane contact sites in vitro:

  • Challenge: Recreating the complex environment of membrane contact sites for biochemical studies.

  • Solutions:

    • Develop synthetic membrane systems with defined lipid compositions

    • Use microfluidic approaches to create artificial membrane contacts

    • Purify functional domains for in vitro lipid transfer assays

• Capturing physiological regulation:

  • Challenge: Laboratory conditions may not reflect the physiological stimuli that regulate GRAMD1A.

  • Solutions:

    • Test multiple physiological and stress conditions (cholesterol loading/depletion, ER stress)

    • Use patient-derived cells to study disease-relevant contexts

    • Develop in vivo models to study regulation in physiological settings

How can researchers differentiate between GRAMD1A's direct effects on cholesterol transport and its secondary effects on signaling pathways in experimental systems?

Differentiating between GRAMD1A's direct effects on cholesterol transport and its secondary effects on signaling pathways requires careful experimental design:

• Temporal separation approaches:

  • Acute manipulation strategies: Use rapid recruitment systems (e.g., rapamycin-induced dimerization) to trigger immediate GRAMD1A localization to ER-PM contacts and monitor cholesterol transport in real-time before secondary signaling effects occur .

  • Time-course analyses: Track the sequence of events following GRAMD1A activation, with cholesterol movement typically preceding signaling changes.

  • Pulse-chase experiments: Use labeled cholesterol analogs to track immediate transport events.

• Domain-specific mutations:

  • Structure-function analysis: Create GRAMD1A variants with mutations in:

    • The VASt domain to specifically disrupt cholesterol binding/transport

    • The GRAM domain to prevent membrane targeting

    • Potential signaling interaction motifs

  • Compare phenotypes to determine which functions are separable .

• Direct vs. indirect readouts:

  • Direct cholesterol transport measurements:

    • Fluorescent cholesterol sensors to directly visualize movement

    • Lipidomic analysis of membrane fractions to quantify cholesterol redistribution

  • Signaling pathway analysis:

    • Phosphorylation status of signaling proteins

    • Transcriptional reporter assays

    • Nuclear translocation of transcription factors

• Pharmacological approaches:

  • Cholesterol manipulation: Use cholesterol depletion (e.g., methyl-β-cyclodextrin) or loading protocols alongside GRAMD1A manipulation.

  • Pathway inhibitors: Apply specific inhibitors of downstream signaling (e.g., STAT5 inhibitors in cancer models) to block secondary effects .

  • Compare timing: Determine if cholesterol transport occurs even when signaling is blocked.

• Reconstitution experiments:

  • In vitro systems: Purify GRAMD1A protein (or relevant domains) and test direct lipid transfer capabilities in artificial membrane systems.

  • Minimal cellular systems: Use cells with simplified signaling architecture to reduce secondary effects.

• Genetic interaction approaches:

  • Epistasis analysis: Determine if manipulating cholesterol levels directly can bypass the need for GRAMD1A in signaling pathways.

  • Suppressor screens: Identify mutations that can restore signaling without restoring cholesterol transport.

Research has shown that in cancer contexts, GRAMD1A regulates STAT5 signaling pathways, affecting cancer stem cell self-renewal, chemoresistance, and tumor growth . Meanwhile, its fundamental function in cholesterol homeostasis involves detecting and facilitating transport of accessible plasma membrane cholesterol to the ER . These distinct roles may be mechanistically linked but can be experimentally separated using the approaches described above.

What emerging technologies could advance our understanding of GRAMD1A functions in lipid metabolism disorders and cancer?

Several cutting-edge technologies hold promise for deepening our understanding of GRAMD1A in disease contexts:

• Advanced imaging technologies:

  • Lattice light-sheet microscopy: Enables long-term 3D imaging with minimal phototoxicity, ideal for tracking GRAMD1A dynamics at membrane contact sites over extended periods.

  • Cryo-electron tomography: Provides structural insights into GRAMD1A-mediated membrane contacts at near-atomic resolution.

  • Single-molecule tracking: Reveals the dynamics of individual GRAMD1A molecules during cholesterol transport events.

• Genome and protein engineering:

  • Base editing and prime editing: Enables precise introduction of disease-associated GRAMD1A variants without DNA breaks.

  • Optogenetic control of GRAMD1A: Allows spatiotemporal control of GRAMD1A recruitment and function using light.

  • Proximity labeling proteomics: Identifies context-specific GRAMD1A interactors in different disease states.

• Single-cell technologies:

  • Single-cell multi-omics: Integrates transcriptomic, proteomic, and lipidomic profiles to understand cell-specific roles of GRAMD1A in heterogeneous tumor microenvironments.

  • Spatial transcriptomics: Maps GRAMD1A expression patterns within tissue architecture, particularly at tumor invasion fronts.

• Organoid and advanced in vitro models:

  • Patient-derived organoids: Tests GRAMD1A function in physiologically relevant 3D models derived from patient tissues.

  • Organ-on-chip technology: Examines GRAMD1A in multicellular contexts with controlled microenvironments.

  • Microfluidic devices: Allows precise manipulation of lipid environments while monitoring GRAMD1A responses.

• In vivo approaches:

  • Tissue-specific conditional knockout mouse models: Evaluates GRAMD1A function in specific tissues at defined developmental stages.

  • Intravital microscopy: Visualizes GRAMD1A-dependent processes in living animals.

  • Patient-derived xenografts with GRAMD1A manipulation: Tests therapeutic approaches targeting GRAMD1A in cancer.

• Computational and systems biology approaches:

  • Network analysis: Identifies how GRAMD1A connects cholesterol metabolism with signaling networks in cancer.

  • Machine learning algorithms: Predicts patient responses to therapies based on GRAMD1A expression patterns and associated biomarkers.

  • Molecular dynamics simulations: Models GRAMD1A structural changes during cholesterol binding and membrane interactions.

These emerging technologies will help bridge current knowledge gaps regarding how GRAMD1A's role in cholesterol transport connects to its functions in disease progression, potentially revealing new therapeutic opportunities.

What are the key methodological considerations for investigating GRAMD1A as a potential therapeutic target in cancer?

Investigating GRAMD1A as a therapeutic target requires systematic approaches across multiple experimental frameworks:

• Target validation strategies:

  • Cancer dependency mapping: Using CRISPR screens to determine cancer types most dependent on GRAMD1A.

  • Synthetic lethality screening: Identifying genetic contexts where GRAMD1A inhibition would be selectively toxic to cancer cells.

  • Biomarker identification: Developing predictive biomarkers for patients likely to respond to GRAMD1A-targeted therapies based on expression patterns and pathway activation .

• Therapeutic modality selection:

  • Small molecule inhibitor development:

    • Structure-based drug design targeting the GRAM or VASt domains.

    • High-throughput screening assays measuring cholesterol transport or STAT5 activation.

    • Chemical probe development to validate target engagement in cells.

  • RNA-based approaches:

    • siRNA/shRNA delivery systems optimized for tumor targeting.

    • Antisense oligonucleotides designed against GRAMD1A.

  • Protein-based therapeutics:

    • Antibodies targeting extracellular or accessible domains.

    • Protein degraders (PROTACs) targeting GRAMD1A for proteasomal degradation.

• Preclinical testing considerations:

  • Appropriate model selection:

    • Patient-derived xenografts that maintain GRAMD1A expression.

    • Genetically engineered mouse models that recapitulate GRAMD1A overexpression.

    • 3D organoid cultures for drug screening.

  • Efficacy parameters:

    • Effects on tumor growth, invasion, and metastasis.

    • Impact on cancer stem cell populations.

    • Changes in chemotherapy sensitivity .

• Mechanism of action studies:

  • Pathway analysis:

    • Comprehensive assessment of STAT5 signaling changes .

    • Effects on cholesterol-dependent signaling pathways.

  • Resistance mechanisms:

    • Identification of compensatory pathways activated upon GRAMD1A inhibition.

    • Potential roles of other GRAMD family members in resistance.

• Combination therapy approaches:

  • Synergy with standard-of-care treatments:

    • Combination with chemotherapy based on GRAMD1A's role in chemoresistance .

    • Evaluation with immunotherapies given GRAMD1A's correlation with immune checkpoint genes .

  • Rational combinations targeting connected pathways:

    • STAT5 inhibitors plus GRAMD1A-targeted therapies .

    • Cholesterol metabolism modulators in combination strategies.

• Biomarker development:

  • Predictive markers:

    • GRAMD1A expression levels.

    • STAT5 pathway activation status.

    • Tumor immune microenvironment profiling .

  • Pharmacodynamic markers:

    • Changes in accessible cholesterol pools.

    • Alterations in STAT5 target gene expression.

These methodological considerations provide a framework for translating the biological understanding of GRAMD1A into potential therapeutic approaches for cancer treatment.

How might researchers investigate the potential crosstalk between GRAMD1A-mediated cholesterol transport and autophagy in disease models?

Investigating the crosstalk between GRAMD1A-mediated cholesterol transport and autophagy requires sophisticated experimental approaches:

• Coordinated manipulation of both pathways:

  • Genetic approaches:

    • GRAMD1A knockout/knockdown in combination with autophagy gene (ATG5, ATG7, etc.) manipulation.

    • CRISPR screens to identify synthetic interactions between GRAMD1A and autophagy components.

    • Domain-specific mutations in GRAMD1A to separate cholesterol transport functions from autophagy-related functions.

  • Pharmacological approaches:

    • Combine GRAMD1A manipulation with autophagy modulators (rapamycin, bafilomycin A1, chloroquine).

    • Cholesterol pathway modulators (statins, cyclodextrin) with autophagy inducers/inhibitors.

• Advanced imaging strategies:

  • Multi-channel live cell imaging:

    • Simultaneous tracking of GRAMD1A, cholesterol sensors, and autophagy markers (LC3, ATG proteins).

    • Correlative light and electron microscopy to visualize membrane contact sites and autophagic structures at ultrastructural level.

  • Super-resolution approaches:

    • Examine spatial relationships between GRAMD1A-positive ER-PM contacts and sites of autophagosome formation.

    • Track cholesterol movement to autophagic membranes using clickable cholesterol analogs.

• Biochemical and lipidomic analyses:

  • Isolation of autophagosomal membranes:

    • Characterize lipid composition with a focus on cholesterol content.

    • Determine if GRAMD1A directly associates with autophagosomal membranes.

  • Flux measurements:

    • Assess if manipulating cholesterol transport via GRAMD1A affects autophagy flux.

    • Determine if autophagy induction/inhibition affects GRAMD1A-mediated cholesterol transport.

• Disease model applications:

  • Cancer models:

    • Examine how GRAMD1A's role in cancer stem cell maintenance might involve autophagy regulation.

    • Investigate if chemoresistance mechanisms linked to GRAMD1A involve autophagy modulation.

  • Neurodegenerative disease models:

    • Study how GRAMD1A-mediated cholesterol transport affects autophagy of protein aggregates.

    • Explore connections to conditions where both cholesterol metabolism and autophagy are disrupted.

  • Metabolic disorders:

    • Examine GRAMD1A function in models of lipid storage diseases where autophagy is often compromised.

• Mechanistic connection studies:

  • Interactome analysis:

    • Proximity labeling to identify shared interaction partners between GRAMD1A and autophagy machinery.

    • Co-immunoprecipitation under various cellular stress conditions.

  • Signaling pathway investigation:

    • Determine if GRAMD1A affects mTOR signaling, a master regulator of autophagy.

    • Examine AMPK activation status in relation to GRAMD1A function.

• Therapeutic implications:

  • Dual pathway modulation:

    • Test if targeting both GRAMD1A and autophagy provides synergistic therapeutic effects in disease models.

    • Develop combination approaches for diseases where both pathways are dysregulated.

Given that GRAMD1A is necessary for autophagosome biogenesis and plays roles in cholesterol transport , exploring this functional intersection could reveal novel disease mechanisms and therapeutic opportunities.

What are the recommended protocols for producing and purifying recombinant GRAMD1A protein for structural and functional studies?

Based on published methodologies, here is a comprehensive protocol for producing and purifying recombinant GRAMD1A:

• Expression system selection:

  • Mammalian expression systems: HEK-293 cells are recommended for full-length GRAMD1A production to ensure proper folding and post-translational modifications .

  • Cell-free protein synthesis (CFPS): An alternative approach that has successfully produced GRAMD1A protein with good yield .

  • Bacterial systems: Suitable for isolated domains (GRAM or VASt) rather than full-length protein.

• Construct design considerations:

  • Tags: His-tag or Strep-tag have been successfully used for GRAMD1A purification .

  • Domain-specific constructs: For structural studies, express individual domains:

    • GRAM domain (N-terminal region)

    • VASt domain (cholesterol-binding region)

    • Transmembrane region may require specialized detergent-based approaches

  • Fusion partners: Consider MBP or SUMO fusion to enhance solubility.

• Expression optimization:

  • For HEK-293 expression:

    • Transfect with optimized plasmid containing strong promoter (CMV).

    • Harvest cells 48-72 hours post-transfection.

    • Consider using suspension-adapted HEK-293 cells for larger-scale production.

  • For CFPS systems:

    • Optimize reaction conditions including template concentration, reaction time, and temperature.

    • Include appropriate chaperones to enhance folding.

• Purification strategy:

  • Initial capture:

    • Affinity chromatography using Ni-NTA (for His-tagged proteins) or Strep-Tactin (for Strep-tagged proteins) .

    • For membrane-associated constructs, include appropriate detergents (DDM, LMNG) in all buffers.

  • Further purification:

    • Ion exchange chromatography to remove contaminants.

    • Size exclusion chromatography (SEC) as a final polishing step and to verify protein homogeneity.

• Quality control assessments:

  • Purity analysis:

    • SDS-PAGE to assess size and purity (>90% purity is achievable) .

    • Western blotting with anti-tag antibodies or specific GRAMD1A antibodies.

  • Functional validation:

    • Cholesterol binding assays for constructs containing the VASt domain.

    • Membrane binding assays for the GRAM domain.

  • Structural integrity:

    • Circular dichroism to assess secondary structure.

    • Thermal shift assays to evaluate stability.

• Storage recommendations:

  • Flash-freeze purified protein in small aliquots.

  • Include glycerol (10-20%) to prevent freeze-thaw damage.

  • For long-term storage, keep at -80°C; for short-term, keep at -20°C.

• Specialized considerations for functional studies:

  • For lipid transfer assays, purify in the absence of cholesterol to ensure binding sites are available.

  • Consider reconstitution into nanodiscs or liposomes for membrane protein studies.

  • For structural studies like X-ray crystallography or cryo-EM, perform additional concentration steps and assess monodispersity by dynamic light scattering.

What computational resources and bioinformatic tools are most valuable for analyzing GRAMD1A structure, function, and clinical significance?

Researchers studying GRAMD1A can leverage numerous computational resources and bioinformatic tools across different aspects of investigation:

• Sequence analysis and evolutionary studies:

  • Sequence databases: UniProt, NCBI Protein, and Ensembl for comprehensive sequence information.

  • Multiple sequence alignment tools: Clustal Omega, MUSCLE, or T-Coffee for comparing GRAMD1A across species or with paralogs.

  • Phylogenetic analysis software: MEGA, PhyML, or MrBayes to study evolutionary relationships among GRAMD family members.

  • Domain prediction tools: SMART, Pfam, and InterPro for identifying functional domains within GRAMD1A.

• Structural analysis and prediction:

  • Protein structure prediction: AlphaFold2 or RoseTTAFold for generating accurate structural models of GRAMD1A domains.

  • Molecular dynamics simulation software: GROMACS, NAMD, or AMBER for studying domain dynamics and lipid interactions.

  • Molecular visualization tools: PyMOL, UCSF Chimera, or VMD for visualizing and analyzing protein structures.

  • Protein-lipid interaction prediction: PLATINUM, PPM Server, or OPM Database for membrane protein orientation and lipid binding site prediction.

• Gene expression and clinical correlation tools:

  • Cancer genomics databases: TCGA, COSMIC, and cBioPortal for analyzing GRAMD1A alterations across cancer types.

  • Survival analysis platforms: Kaplan-Meier plotter, GEPIA2, and UALCAN for correlating GRAMD1A expression with patient outcomes .

  • Gene set enrichment analysis (GSEA): To identify biological pathways associated with GRAMD1A expression .

  • Single-cell analysis tools: Seurat, Scanpy, or cellranger for examining GRAMD1A expression at the single-cell level.

• Immune infiltration and microenvironment analysis:

  • Immune infiltration algorithms: CIBERSORT, xCell, or TIMER for analyzing correlations between GRAMD1A and immune cell populations .

  • Immunotherapy response prediction: TIDE or ImmuCellAI for correlating GRAMD1A with immunotherapy outcomes.

  • Tumor microenvironment databases: TISIDB for examining relationships between GRAMD1A and immune-related factors .

• Multi-omics integration platforms:

  • Network analysis tools: Cytoscape, STRING, or GeneMANIA for constructing protein-protein interaction networks involving GRAMD1A.

  • Multi-omics integration: iClusterPlus, SNF, or MOFA for integrating GRAMD1A-related data across different omics layers.

  • Systems biology platforms: Ingenuity Pathway Analysis or MetaCore for placing GRAMD1A in biological context.

• Drug development and virtual screening:

  • Druggability assessment: PockDrug, SiteMap, or fpocket for identifying potential binding sites in GRAMD1A.

  • Virtual screening software: AutoDock, Glide, or DOCK for in silico screening of potential GRAMD1A inhibitors.

  • ADMET prediction tools: SwissADME, ADMETlab, or pkCSM for predicting drug-like properties of potential GRAMD1A-targeting compounds.

• Specialized tools for lipid metabolism:

  • Lipid-protein interaction databases: LipidBank or LIPIDAT for information on cholesterol interactions.

  • Membrane protein topology prediction: TMHMM, Phobius, or TOPCONS for predicting GRAMD1A membrane orientation.

  • Lipid transfer protein analysis: LTP Hunter or Membranome for comparative analysis with other lipid transfer proteins.

What are the most reliable antibodies and molecular tools for studying GRAMD1A in different experimental systems?

Based on published research, here are the most reliable tools for studying GRAMD1A across different experimental systems:

• Antibodies for protein detection:

  • Monoclonal antibodies:

    • Several monoclonal antibodies have been developed specifically against GRAMD1A, enabling detection in various tissues and tumor cell lines .

    • These antibodies have been validated for techniques including Western blotting, immunohistochemistry, and ELISA .

  • Application-specific recommendations:

    • For Western blotting: Anti-GRAMD1A antibodies that recognize epitopes outside functional domains.

    • For immunoprecipitation: Antibodies validated for native protein recognition.

    • For immunofluorescence: Antibodies tested for specificity in both fixed and live cells.

• Expression vectors and constructs:

  • Tagged constructs for localization:

    • GRAMD1A-eGFP: Particularly useful for live cell imaging of dynamic recruitment to ER-PM contact sites .

    • mCherry-GRAMD1A: Alternative fluorescent tag useful for dual-color imaging.

  • Domain-specific constructs:

    • GRAM domain constructs for phospholipid binding studies.

    • VASt domain constructs for cholesterol binding/transport studies.

    • Transmembrane region constructs for oligomerization studies.

  • Inducible systems:

    • FKBP-FRB rapamycin-inducible GRAMD1A recruitment systems for acute manipulation studies .

    • Tet-inducible expression systems for controlled GRAMD1A expression.

• Genome editing tools:

  • CRISPR-Cas9 knockout strategies:

    • Guide RNAs targeting exon 13 of GRAMD1A have been successfully used to disrupt the gene .

    • Complete validation protocols include genomic sequencing, Western blotting, and functional assays.

  • Knock-in approaches:

    • CRISPR-mediated endogenous tagging of GRAMD1A for physiological expression level studies.

• RNA interference tools:

  • siRNA sequences:

    • Target regions with minimal off-target effects, typically in coding regions unique to GRAMD1A.

    • Use multiple independent siRNAs to confirm specificity of phenotypes.

  • shRNA constructs:

    • For stable knockdown experiments, particularly useful in long-term studies.

• Detection reagents for functional studies:

  • Cholesterol sensors:

    • EGFP-D4H probe: Essential tool for visualizing the accessible pool of PM cholesterol in real-time .

    • This probe has been instrumental in revealing GRAMD1A's role in cholesterol transport.

  • Membrane contact site markers:

    • ER markers (e.g., Sec61β) combined with PM markers for visualizing contact sites.

    • Split fluorescent protein systems for specific labeling of contact sites.

• Recombinant proteins:

  • Purified GRAMD1A protein:

    • Full-length human GRAMD1A with His tag or Strep tag for in vitro studies .

    • Expression in HEK-293 cells or using cell-free protein synthesis systems has yielded functional protein .

  • Domain-specific proteins:

    • Isolated GRAM domain for lipid binding studies.

    • VASt domain for cholesterol transport assays.

• PCR primers and probes:

  • qPCR primers:

    • Forward: GATGCTCTCTTCTCGGACTCG

    • Reverse: GATGGGGATGGTGTACGTC

    • These primers have been validated for GRAMD1A expression analysis in various tissues and cell lines .

  • Reference gene recommendations:

    • β-actin has been successfully used as a reference gene for GRAMD1A expression studies .