Recombinant Human Interferon regulatory factor 2-binding protein 2 (IRF2BP2)

What is IRF2BP2 and what are its primary biological functions?

IRF2BP2 (Interferon Regulatory Factor 2-Binding Protein 2) is a transcriptional co-repressor that was initially identified as a binding partner of IRF2. It contains an N-terminal zinc finger domain and a C-terminal RING domain, both of which are essential for its repressive function . IRF2BP2 plays diverse roles in multiple biological processes, including:

• Repression of NFAT1-mediated transcriptional activity in T cells, affecting cytokine production including IL-2 and IL-4

• Regulation of pathological cardiac hypertrophy by directly repressing NFAT1-mediated hypertrophic transcriptome

• Modulation of macrophage polarization toward anti-inflammatory M2 phenotype through regulation of KLF2 expression

• Counteraction of inflammatory pathway activation in acute myeloid leukemia (AML) cells by interacting with the AP-1 heterodimer ATF7/JDP2

The protein requires nuclear localization to exert its repressive effects, as mutations in its nuclear localization signal abolish its function .

What experimental models are available for studying IRF2BP2 function?

Several experimental models have been developed to study IRF2BP2 function:

• Conditional Irf2bp2 gene knockout mouse line: This model allows tissue-specific deletion of IRF2BP2 and has been used to demonstrate that cardiac-specific loss of IRF2BP2 exacerbates pathological cardiac hypertrophy

• Conditional Irf2bp2 transgenic mouse line: This complementary model enables tissue-specific overexpression of IRF2BP2 and has shown that cardiac-specific IRF2BP2 overexpression inhibits pathological cardiac hypertrophy

• Macrophage-specific IRF2BP2-deficient mice: These animals develop severe atherosclerosis and exhibit impaired M2 macrophage polarization

• AML cell lines with manipulated IRF2BP2 expression: Used to study the role of IRF2BP2 in regulating inflammatory pathways in leukemia cells

These models allow researchers to investigate the tissue-specific functions of IRF2BP2 in various physiological and pathological contexts.

How can IRF2BP2 expression be detected in experimental samples?

Detection of IRF2BP2 expression can be achieved through several complementary approaches:

RNA-level detection:

• RT-PCR using target-specific primers: For example, primers positioned in exon 1 (F1: 5'-TCGAGTTCGTCATCGAGACGGC-3' and R1: 5'-TGCTGCCGAAGTCAGAGCCGAGG-3') can amplify a 263bp product of IRF2BP2 transcript 2 (NM_001077397.1)

• Allele-specific PCR assays can be designed to differentiate between wild-type and mutant alleles, especially useful when studying frameshift variants

Protein-level detection:

• Western blotting using anti-IRF2BP2 antibodies to assess protein levels in tissues or cell lysates

• Immunohistochemistry or immunofluorescence microscopy to visualize IRF2BP2 localization in cells and tissues

Reporter assays:

• Gene reporter assays using NFAT-responsive promoters can indirectly demonstrate IRF2BP2 activity through its repressive effect on NFAT1-dependent transactivation

What protein interactions have been established for IRF2BP2?

IRF2BP2 has been shown to interact with several proteins that contribute to its biological functions:

• NFAT1: IRF2BP2 specifically interacts with the C-terminal domain of NFAT1 among the NFAT family members, acting as a transcriptional repressor

• MEF2C (Myocyte-specific Enhancer Factor 2C): IRF2BP2 competes with MEF2C for binding to the C-terminal transactivation domain of NFAT1, disrupting their transcriptional synergism

• IRF2: As its name suggests, IRF2BP2 binds to Interferon Regulatory Factor 2 and acts as its corepressor

• p53: IRF2BP2 can influence p53-mediated transactivation of p21 and Bax promoters

• ATF7/JDP2 heterodimer: In AML cells, IRF2BP2 interacts with this AP-1 heterodimer to counteract its gene-activating function in inflammatory pathways

These interactions highlight IRF2BP2's role as a versatile transcriptional co-regulator affecting multiple signaling pathways.

What is the molecular mechanism by which IRF2BP2 regulates NFAT1-mediated transcription?

IRF2BP2 regulates NFAT1-mediated transcription through a competitive binding mechanism:

• IRF2BP2 specifically interacts with the C-terminal transactivation domain (TAD) of NFAT1, but not with other NFAT family members, suggesting a highly specific regulatory mechanism

• Mechanistically, IRF2BP2 competes with MEF2C (Myocyte-specific Enhancer Factor 2C) for binding to the C-terminal TAD of NFAT1

• This competitive binding disrupts the transcriptional synergism between NFAT1 and MEF2C, which is essential for the activation of hypertrophic gene programs

• For this repressive function, IRF2BP2 requires both its zinc finger domain and RING domain, which are necessary for proper protein-protein interactions and potentially for recruiting additional co-repressors

• Nuclear localization of IRF2BP2 is essential for its repressive function, as mutations in its nuclear localization signal render it cytoplasmic and abolish its ability to repress NFAT1 activity

The functional consequence of this mechanism has been demonstrated in T cells, where ectopic expression of IRF2BP2 results in decreased production of interleukin-2 (IL-2) and IL-4, which are key NFAT1 target genes .

How does IRF2BP2 contribute to cardiac hypertrophy regulation?

IRF2BP2 plays a crucial role in regulating pathological cardiac hypertrophy through the following mechanisms:

• Elevated expression in hypertrophy: IRF2BP2 protein levels are increased in both mouse and human hypertrophied myocardium, suggesting a compensatory response to hypertrophic stimuli

• Protective effect against hypertrophy: Cardiac-specific overexpression of IRF2BP2 inhibits pathological cardiac hypertrophy in mouse models, while cardiac-specific deletion of IRF2BP2 exacerbates the condition

• Transcriptional repression mechanism: IRF2BP2 acts as a transcription corepressor of NFAT1 (Nuclear Factor of Activated T-cells 1) and represses the NFAT1-mediated hypertrophic transcriptome

• Competitive binding: IRF2BP2 inhibits NFAT1 transcriptional activity by competing with MEF2C (Myocyte-specific Enhancer Factor 2C) for binding to the C-terminal transactivation domain of NFAT1, thereby disrupting their transcriptional synergism

• Therapeutic potential: Targeting NFAT1 at the effector phase of hypertrophic signaling via IRF2BP2 holds promise for treating cardiac hypertrophy, especially given the limited pharmacological therapies currently available

These findings suggest that IRF2BP2 functions as an endogenous repressor of pathological cardiac growth, opening avenues for potential therapeutic interventions targeting this pathway.

What are the implications of IRF2BP2 mutations in human diseases?

IRF2BP2 mutations have significant implications for human diseases, particularly immunodeficiencies:

• Common Variable Immunodeficiency (CVID): Haploinsufficiency of IRF2BP2 leads to CVID, characterized by hypogammaglobulinemia and recurrent infections

• CVID with inflammatory complications: Recent studies have defined a more accurate phenotype associated with truncating variants in IRF2BP2, manifesting as CVID with gastrointestinal inflammatory symptoms and autoimmune manifestations

• Types of pathogenic variants: Most disease-causing mutations in IRF2BP2 are frameshift variants that result in loss-of-function (LoF) through the generation of premature termination codons (PTCs)

• Inheritance patterns: Both de novo mutations and autosomal dominant inheritance with incomplete penetrance have been observed in families with IRF2BP2-related immunodeficiency

• Large genomic deletions: In addition to small frameshifts, large deletions encompassing the entire IRF2BP2 gene have been reported to cause immunodeficiency, confirming that haploinsufficiency is the primary disease mechanism

• Viral susceptibility: Some patients with IRF2BP2 mutations exhibit predisposition to viral infections, highlighting the protein's role in antiviral immunity

Understanding these disease associations provides insight into the critical role of IRF2BP2 in immune regulation and identifies potential therapeutic targets for affected individuals.

What techniques are optimal for purifying recombinant IRF2BP2 protein for functional studies?

Purification of recombinant IRF2BP2 protein for functional studies requires specific approaches to maintain protein integrity and activity:

• Expression systems:

  • Bacterial expression systems using pET vectors have been successful for expressing the C-terminal domain of IRF2BP2 (amino acids 439 to 571) as a GST fusion protein

  • For full-length protein expression, mammalian or insect cell expression systems may be preferable due to the need for proper folding and potential post-translational modifications

• Affinity purification strategies:

  • FLAG-tag purification: Anti-FLAG M2 affinity gel (Sigma) has been used successfully for IRF2BP2 purification

  • GST fusion proteins: The pET-GST-Tev vector system allows expression of GST-tagged IRF2BP2 fragments with a Tev protease cleavage site for tag removal

• Purification protocol example:

  • Prepare anti-FLAG M2 affinity gel by washing with TAP buffer (50 mM Tris–Cl pH 7.9, 100 mM KCl, 5 mM MgCl₂, 0.2 mM EDTA, 10% glycerol, 0.2 mM PMSF, 1 mM DTT)

  • Wash three times with 100 mM glycine (pH 2.5)

  • Wash once with 1 M Tris–Cl (pH 7.9)

  • Wash once more with TAP buffer

  • Add cell extract to beads and rotate at 4°C for 4 hours

  • Wash three times with TAP buffer to remove unbound material

• Buffer optimization:

  • Include protease inhibitors to prevent degradation

  • Optimize salt concentration to maintain protein solubility while preserving protein-protein interactions

  • Consider adding reducing agents (DTT or β-mercaptoethanol) to prevent oxidation of cysteine residues in the zinc finger and RING domains

• Quality control:

  • Verify purified protein integrity by SDS-PAGE and western blotting

  • Assess activity through in vitro binding assays with known interaction partners such as NFAT1

Proper purification of recombinant IRF2BP2 is essential for downstream applications including structural studies, interaction assays, and functional characterization.

How does IRF2BP2 function in inflammation and macrophage polarization?

IRF2BP2 plays a significant role in regulating inflammation and macrophage polarization through several mechanisms:

• M2 macrophage polarization: IRF2BP2 promotes the differentiation of anti-inflammatory M2-type macrophages by regulating the expression of Krüppel-like factor 2 (KLF2), a key anti-inflammatory transcription factor

• Atherosclerosis protection: Mice with IRF2BP2-deficient macrophages develop severe atherosclerosis, highlighting its role in preventing inflammatory vascular disease

• Microglial function: Loss of IRF2BP2 in microglia is associated with reduced activation of M2 anti-inflammatory markers and increased expression of inflammatory cytokines, suggesting a role in central nervous system inflammation

• Inflammatory pathway regulation in cancer: In acute myeloid leukemia (AML) cells, IRF2BP2 interacts with the AP-1 heterodimer ATF7/JDP2 to counteract its gene-activating function in inflammatory pathways. Loss of IRF2BP2 leads to overactivation of inflammatory pathways, resulting in reduced cell proliferation

• Balance of inflammatory responses: IRF2BP2 helps maintain a precise equilibrium between activating and repressive transcriptional mechanisms to create a pro-oncogenic inflammatory environment in AML cells, suggesting that inflammatory regulation is context-dependent

These findings demonstrate that IRF2BP2 serves as a critical negative regulator of inflammatory responses across multiple cell types and disease contexts, making it a potential therapeutic target for inflammatory disorders.

What methodologies are recommended for studying IRF2BP2 binding to chromatin?

To investigate IRF2BP2 binding to chromatin, researchers should consider the following methodologies:

• Chromatin Immunoprecipitation (ChIP) approaches:

  • Standard ChIP using anti-IRF2BP2 antibodies can identify genomic binding regions

  • ChIP-seq provides genome-wide binding profiles of IRF2BP2

  • For improved resolution, consider CUT&RUN or CUT&Tag technologies that offer lower background and require fewer cells

  • ChIP-exo or ChIP-nexus can provide near base-pair resolution of binding sites

• Sequential ChIP (Re-ChIP):

  • To investigate co-occupancy of IRF2BP2 with interaction partners like NFAT1 or ATF7/JDP2, sequential ChIP can be employed

  • First immunoprecipitate with anti-IRF2BP2 antibodies, then perform a second IP with antibodies against the potential partner protein

• Reporter assays for functional validation:

  • Luciferase reporter constructs containing IRF2BP2 binding regions can validate the functional significance of identified binding sites

  • Mutation of predicted binding sites can confirm direct effects

• Recombinant protein binding assays:

  • Electrophoretic mobility shift assays (EMSA) using purified recombinant IRF2BP2 can confirm direct DNA binding

  • DNA-protein interaction ELISA or microscale thermophoresis can quantify binding affinities

• Mass spectrometry approaches:

  • Comprehensive identification of chromatin-associated IRF2BP2 protein complexes can be achieved through ChIP followed by mass spectrometry (ChIP-MS)

  • As noted in the literature, specific protocols for mass spectrometry analysis of IRF2BP2-associated proteins have been developed

• Recruitment analysis:

  • The research shows that IRF2BP2 is recruited by the ATF7/JDP2 dimer to chromatin, suggesting that studying IRF2BP2 binding should include analysis of these partner proteins

  • ChIP-seq for both IRF2BP2 and its recruiting factors will provide insights into the mechanisms of chromatin targeting

These methodologies provide complementary approaches to understanding the genomic binding patterns and functional consequences of IRF2BP2 chromatin association.

How can RT-PCR be optimized to detect IRF2BP2 frameshift variants?

Detection of IRF2BP2 frameshift variants requires optimized RT-PCR strategies, as demonstrated in recent research:

• Primer design considerations:

  • Design primers that flank the variant region to detect size differences between wild-type and mutant transcripts

  • For variants in exon 1, primers can be positioned upstream of predicted premature termination codons (PTCs) to ensure detection of mutant transcripts

  • Example primer set: Forward primer F1 (5'-TCGAGTTCGTCATCGAGACGGC-3') and reverse primer R1 (5'-TGCTGCCGAAGTCAGAGCCGAGG-3') positioned in exon 1 flanking the c.217_244del variant (yielding a 263bp wild-type product and 235bp mutant product)

• PCR optimization for GC-rich regions:

  • IRF2BP2 contains GC-rich regions that can be challenging to amplify

  • Use specialized PCR systems such as the GC-RICH PCR System dNTPack (Roche) for reliable amplification

  • Optimize thermocycler programs: e.g., 95°C-3 min initial denaturation, followed by 30 cycles of 95°C-30s, 60°C-30s, 72°C-30s, and final extension at 72°C-1 min

• Allele-specific PCR approaches:

  • Design primers that specifically target either wild-type or mutant sequences

  • Utilize nearby polymorphic sites to differentiate alleles (e.g., c.991C>T polymorphism)

  • For allele-specific PCR, more stringent annealing conditions may be required (e.g., 66°C annealing temperature)

• Controls and validation:

  • Always include amplification of a ubiquitously expressed endogenous control gene (e.g., RPL19) to verify RNA quality and cDNA synthesis

  • Confirm PCR products by Sanger sequencing to validate the presence of the predicted variant

  • Consider semi-quantitative assessment through cDNA concentration measurements to estimate expression levels of wild-type versus mutant alleles

By implementing these optimized RT-PCR strategies, researchers can reliably detect and characterize IRF2BP2 frameshift variants in patient samples and experimental models.

What is the role of IRF2BP2 in acute myeloid leukemia (AML) cells?

IRF2BP2 plays a crucial role in regulating inflammatory pathways in acute myeloid leukemia (AML) cells, with significant implications for leukemia progression:

• Interaction with AP-1 heterodimers: IRF2BP2 specifically interacts with the ATF7/JDP2 AP-1 heterodimer, which is involved in activating inflammatory pathways in AML cells

• Chromatin recruitment mechanism: IRF2BP2 is recruited to chromatin by the ATF7/JDP2 dimer, where it acts to counteract the gene-activating function of this AP-1 complex

• Inflammatory pathway regulation: IRF2BP2 functions as a repressor of inflammatory gene activation in AML cells. Loss of IRF2BP2 leads to overactivation of inflammatory pathways

• Cell proliferation effects: Overactivation of inflammatory pathways resulting from IRF2BP2 loss strongly reduces AML cell proliferation, suggesting that precise regulation of inflammation is critical for leukemia progression

• Pro-oncogenic balance: Research indicates that a precise equilibrium between activating and repressive transcriptional mechanisms creates a pro-oncogenic inflammatory environment in AML cells. The ATF7/JDP2-IRF2BP2 regulatory axis appears to be a key regulator of this balance

• Therapeutic implications: The ATF7/JDP2-IRF2BP2 regulatory axis may represent a promising therapeutic vulnerability for AML treatment. Targeting this pathway could potentially disrupt the delicate inflammatory balance required for leukemia cell survival and proliferation

These findings highlight IRF2BP2 as a critical modulator of inflammatory responses in AML, providing new insights into leukemia pathogenesis and identifying potential therapeutic approaches.

What are the recommended protocols for generating recombinant IRF2BP2 expression constructs?

Based on published research, the following protocols are recommended for generating recombinant IRF2BP2 expression constructs:

For full-length IRF2BP2:

• Amplify the complete IRF2BP2 coding sequence from human cDNA using high-fidelity DNA polymerase

• For challenging GC-rich regions, use specialized PCR systems like the GC-RICH PCR System dNTPack (Roche)

• Clone the amplified sequence into appropriate expression vectors:

  • For mammalian expression: vectors with CMV promoters (e.g., pcDNA3.1) with N- or C-terminal tags (FLAG, HA, etc.)

  • For bacterial expression: pET vector systems with purification tags (His, GST, etc.)

For domain-specific constructs:

• The C-terminal end of IRF2BP2 (amino acids 439 to 571) containing the RING domain can be effectively expressed using the pET-GST-Tev vector system

• For the N-terminal zinc finger domain, similar approaches with appropriate domain boundaries can be employed

Verification of constructs:

• Confirm sequence integrity by Sanger sequencing, particularly in GC-rich regions

• For PCR amplification of IRF2BP2 exon 1, use specific primers designed to avoid repeat masker sequences:

  • Forward: 3'GGACTTCACCGAACCCGTCT 5'

  • Reverse: 5'GGCTGCTGCCGAAGTCAGAG 3'

• For Sanger sequencing verification, these primers have proven effective:

  • Forward: 3'AACGGCTTCTCCAAGCTAGA 5'

  • Reverse: 5'GAATGTGCTGGGAAAGGAAA 3'

Expression validation:

• Confirm protein expression by Western blotting using tag-specific antibodies or IRF2BP2-specific antibodies

• Verify subcellular localization by immunofluorescence to ensure proper nuclear localization, which is critical for IRF2BP2 function

These protocols have been successfully employed in published research and provide a foundation for generating reliable IRF2BP2 expression constructs for various experimental applications.

How can researchers effectively study the interaction between IRF2BP2 and NFAT1?

To effectively study the interaction between IRF2BP2 and NFAT1, researchers can employ multiple complementary approaches:

• Co-immunoprecipitation (Co-IP) assays:

  • Immunoprecipitate endogenous or tagged IRF2BP2 from cell lysates using specific antibodies

  • Probe the immunoprecipitate for NFAT1 by Western blotting to detect the interaction

  • Perform reciprocal Co-IP by immunoprecipitating NFAT1 and probing for IRF2BP2

  • Include appropriate controls: IgG control, input samples, and lysates from cells with knockdown/knockout of either protein

• Domain mapping through truncation mutants:

  • Generate truncated versions of both IRF2BP2 and NFAT1 to identify the minimal interacting domains

  • Research has shown that IRF2BP2 specifically interacts with the C-terminal domain of NFAT1

  • Test interactions using Co-IP or GST pulldown assays

• GST pulldown assays:

  • Express GST-tagged fragments of IRF2BP2 (e.g., C-terminal region containing the RING domain) in bacterial systems

  • Incubate purified GST-IRF2BP2 with cell lysates containing NFAT1 or with purified NFAT1 protein

  • Detect binding by Western blotting for NFAT1

• Functional reporter assays:

  • Use NFAT-responsive luciferase reporter constructs to assess the functional consequences of the interaction

  • Co-transfect cells with expression vectors for NFAT1, IRF2BP2, and NFAT-responsive reporters

  • Evaluate how IRF2BP2 affects NFAT1-dependent transcriptional activation

• Competitive binding assays:

  • Since IRF2BP2 competes with MEF2C for binding to NFAT1 , design experiments with varying concentrations of IRF2BP2 and MEF2C to demonstrate competition

  • Use labeled proteins and techniques like FRET or AlphaScreen to quantify binding dynamics

• Subcellular co-localization studies:

  • Perform immunofluorescence microscopy to visualize co-localization of IRF2BP2 and NFAT1 in the nucleus of activated cells

  • Use confocal microscopy for high-resolution co-localization analysis

  • Include stimulation conditions that activate NFAT1 nuclear translocation (e.g., ionomycin/PMA treatment)

• Chromatin immunoprecipitation (ChIP) analyses:

  • Perform ChIP-seq for both IRF2BP2 and NFAT1 to identify genomic regions where both proteins co-occupy

  • Follow with sequential ChIP (Re-ChIP) to confirm simultaneous binding at specific loci

These methodologies provide a comprehensive toolkit for characterizing the IRF2BP2-NFAT1 interaction at molecular, cellular, and functional levels.

What experimental approaches can verify the repressive effect of IRF2BP2 on gene expression?

To verify the repressive effect of IRF2BP2 on gene expression, researchers can employ the following experimental approaches:

• Reporter gene assays:

  • Construct luciferase reporters containing promoters of known or suspected IRF2BP2 target genes

  • Co-transfect cells with IRF2BP2 expression vectors and reporter constructs

  • Measure luciferase activity to quantify the repressive effect of IRF2BP2 on transcription

  • Include dose-dependency by transfecting increasing amounts of IRF2BP2 expression vector

  • Research has demonstrated that IRF2BP2 represses NFAT1-dependent transactivation of NFAT-responsive promoters using this approach

• Gene expression analysis after IRF2BP2 manipulation:

  • Perform gain-of-function experiments by overexpressing IRF2BP2 in relevant cell types

  • Conduct loss-of-function studies using siRNA/shRNA knockdown or CRISPR/Cas9 knockout of IRF2BP2

  • Measure expression changes of target genes using RT-qPCR, RNA-seq, or protein analysis

  • Published studies show that ectopic expression of IRF2BP2 in CD4 T cells decreased IL-2 and IL-4 production, supporting its repressive function

• Chromatin immunoprecipitation (ChIP) studies:

  • Perform ChIP using anti-IRF2BP2 antibodies to identify genomic binding sites

  • Correlate IRF2BP2 binding with repressive histone modifications (H3K27me3, H3K9me3)

  • Analyze the presence of other transcriptional repressors at IRF2BP2-bound sites

  • Research has shown that IRF2BP2 is recruited by the ATF7/JDP2 dimer to chromatin and counteracts its gene-activating function

• Analysis of chromatin accessibility:

  • Use ATAC-seq or DNase-seq to assess how IRF2BP2 binding affects chromatin accessibility

  • Compare regions with IRF2BP2 binding to changes in chromatin structure

• Co-repressor recruitment assays:

  • Investigate whether IRF2BP2 recruits additional co-repressor proteins to target loci

  • Perform mass spectrometry analysis of IRF2BP2-associated proteins to identify potential co-repressors

  • Verify these interactions using co-immunoprecipitation and functional assays

• In vivo models:

  • Utilize the conditional Irf2bp2 knockout and transgenic mouse models to assess target gene expression in relevant tissues

  • For cardiac studies, cardiac-specific manipulation of IRF2BP2 expression has demonstrated effects on the NFAT1-mediated hypertrophic transcriptome

  • For immune cell studies, assess cytokine production in cells with altered IRF2BP2 expression

• Competition assays:

  • Since IRF2BP2 can compete with activators like MEF2C for binding to transcription factors such as NFAT1 , design experiments to demonstrate this competitive mechanism

  • Use purified proteins in binding assays with varying concentrations to show competition for binding sites

These approaches provide comprehensive evidence for the repressive function of IRF2BP2 at molecular, cellular, and organismal levels.

How do frameshift variants in IRF2BP2 lead to immunodeficiency disorders?

Frameshift variants in IRF2BP2 lead to immunodeficiency disorders through several molecular and cellular mechanisms:

• Haploinsufficiency mechanism:

  • Most disease-causing IRF2BP2 mutations are frameshift variants that create premature termination codons (PTCs)

  • These mutations result in loss-of-function (LoF) through haploinsufficiency, where a single functional copy of the gene is insufficient for normal immune function

  • RT-PCR analysis has demonstrated that carriers of frameshift variants (e.g., c.217_244del) express approximately half the amount of wild-type IRF2BP2 cDNA compared to controls, confirming the haploinsufficiency mechanism

• Impact on immune cell function:

  • IRF2BP2 normally represses NFAT1-dependent transcription of cytokines like IL-2 and IL-4 in T cells

  • Loss of this repressive function likely leads to dysregulated cytokine production and altered T cell responses

  • Given IRF2BP2's role in macrophage polarization toward anti-inflammatory phenotypes , haploinsufficiency may contribute to the inflammatory manifestations seen in patients

• Clinical spectrum of IRF2BP2 deficiency:

  • Common Variable Immunodeficiency (CVID) is the primary phenotype, characterized by hypogammaglobulinemia and recurrent infections

  • Gastrointestinal inflammatory symptoms and autoimmune manifestations are frequently observed

  • Some patients exhibit increased susceptibility to viral infections, suggesting a role for IRF2BP2 in antiviral immunity

  • Both de novo mutations and autosomal dominant inheritance with incomplete penetrance have been observed, indicating variable expressivity of the phenotype

• Large genomic deletions:

  • Beyond small frameshifts, large deletions encompassing the entire IRF2BP2 gene have also been associated with immunodeficiency, further supporting haploinsufficiency as the disease mechanism

Understanding these mechanisms provides insight into the pathogenesis of IRF2BP2-related immunodeficiency and may guide the development of targeted therapeutic approaches for affected individuals.

What is known about the role of IRF2BP2 in tumorigenesis?

IRF2BP2 has emerging roles in tumorigenesis through its regulation of several key pathways involved in cancer development:

• Regulation of inflammatory pathways in cancer cells:

  • In acute myeloid leukemia (AML) cells, IRF2BP2 interacts with the AP-1 heterodimer ATF7/JDP2 to counteract inflammatory gene activation

  • Loss of IRF2BP2 leads to overactivation of inflammatory pathways, resulting in strongly reduced proliferation of AML cells

  • A precise equilibrium between activating and repressive transcriptional mechanisms appears to create a pro-oncogenic inflammatory environment in AML cells, with the ATF7/JDP2-IRF2BP2 regulatory axis as a key regulator

• Modulation of p53 pathway:

  • IRF2BP2 can influence p53-mediated transactivation of p21 and Bax promoters, which are critical for cell cycle control and apoptosis

  • This interaction with the p53 pathway suggests a potential role in tumor suppression or oncogenesis depending on context

• Immune microenvironment modulation:

  • IRF2BP2 regulates macrophage polarization toward an anti-inflammatory M2 phenotype

  • Since tumor-associated macrophages with M2-like phenotypes often promote tumor progression, IRF2BP2 may influence the tumor microenvironment by affecting macrophage function

• Potential involvement in multiple cancer types:

  • While detailed research has focused on AML, the regulation of fundamental pathways like inflammation, p53 signaling, and immune responses suggests IRF2BP2 may have roles in multiple cancer types

  • The ATF7/JDP2-IRF2BP2 regulatory axis may represent a therapeutic vulnerability that could be exploited for cancer treatment

• Context-dependent functions:

  • The precise role of IRF2BP2 in tumorigenesis likely depends on cellular context, as it can act as either a positive or negative regulator of various pathways

  • In some contexts, it may function as a tumor suppressor by limiting inflammation, while in others it may contribute to creating an optimal inflammatory environment for cancer cell proliferation

These findings highlight IRF2BP2 as an important player in tumor development and progression, particularly through its regulation of inflammatory pathways and immune responses in the tumor microenvironment.

How can genetic screening for IRF2BP2 variants be optimized for clinical applications?

Optimizing genetic screening for IRF2BP2 variants in clinical applications requires a comprehensive approach:

• Target region considerations:

  • Include the entire coding sequence of IRF2BP2, with particular attention to exon 1 where several pathogenic variants have been identified

  • Design primers that effectively amplify GC-rich regions, which are common in IRF2BP2:

    • For exon 1 amplification: Forward primer 3'GGACTTCACCGAACCCGTCT 5' and reverse primer 5'GGCTGCTGCCGAAGTCAGAG 3'

    • For sequencing: Forward primer 3'AACGGCTTCTCCAAGCTAGA 5' and reverse primer 5'GAATGTGCTGGGAAAGGAAA 3'

• Sequencing methodology:

  • High-throughput sequencing panels including IRF2BP2 are effective for screening patients with suspected primary immunodeficiency

  • Include IRF2BP2 in targeted gene panels for Common Variable Immunodeficiency (CVID) and combined immunodeficiencies

  • For single-gene testing, Sanger sequencing remains valuable for confirming variants identified by panel testing

• Copy number variant (CNV) detection:

  • Incorporate CNV analysis to detect large deletions encompassing IRF2BP2, as these have been identified in patients with immunodeficiency

  • Methods such as MLPA (Multiplex Ligation-dependent Probe Amplification), array CGH, or NGS-based CNV calling algorithms can be used

• Variant interpretation guidelines:

  • Prioritize frameshift, nonsense, and splice site variants that lead to premature termination codons, as haploinsufficiency is the established disease mechanism

  • Consider large genomic deletions as potentially pathogenic

  • Evaluate missense variants carefully, as their pathogenicity is less established

• RNA analysis for variant effect validation:

  • When novel variants are identified, consider RT-PCR analysis to assess their effect on transcript levels:

    • Use primers positioned upstream of predicted premature termination codons

    • Compare expression levels of wild-type vs. mutant alleles to confirm haploinsufficiency

    • For example, cDNA analysis from Family 1 in the study revealed approximately half the amount of wild-type IRF2BP2 cDNA in carriers of the c.217_244del variant compared to controls

• Clinical correlation:

  • Consider the full clinical spectrum of IRF2BP2-related disorders including:

    • CVID with hypogammaglobulinemia

    • Gastrointestinal inflammatory symptoms

    • Autoimmune manifestations

    • Viral susceptibility

  • Note that incomplete penetrance has been observed, so family studies are valuable for variant interpretation

These approaches will enhance the sensitivity and specificity of IRF2BP2 variant detection and interpretation in clinical settings.

What functional assays can validate the pathogenicity of novel IRF2BP2 variants?

Validating the pathogenicity of novel IRF2BP2 variants requires a multi-tiered approach using complementary functional assays:

• RNA-level analyses:

  • RT-PCR to detect expression of mutant transcripts:

    • Design primers flanking the variant to distinguish wild-type and mutant products

    • For variants in exon 1, primers like F1 (5'-TCGAGTTCGTCATCGAGACGGC-3') and R1 (5'-TGCTGCCGAAGTCAGAGCCGAGG-3') have been successfully used

  • Quantitative RT-PCR to assess relative expression levels of wild-type vs. mutant alleles:

    • Research has shown carriers of pathogenic variants express approximately half the amount of wild-type IRF2BP2 cDNA compared to controls

  • Allele-specific PCR utilizing nearby polymorphic sites (e.g., c.991C>T) to differentiate expression from each allele

• Protein-level analyses:

  • Western blotting to assess protein expression levels and detect truncated products

  • Immunofluorescence microscopy to evaluate subcellular localization, as nuclear localization is essential for IRF2BP2 function

  • Co-immunoprecipitation assays to test interaction with known partners (NFAT1, ATF7/JDP2) that are critical for IRF2BP2 function

• Transcriptional repression assays:

  • Luciferase reporter assays with NFAT-responsive promoters to assess the variant's impact on IRF2BP2's repressive function

  • Cotransfection of wild-type or variant IRF2BP2 with NFAT1 and comparison of reporter activity

  • Cell-based assays measuring endogenous target gene expression (e.g., IL-2, IL-4) after transient expression of wild-type or variant IRF2BP2

• Functional immune cell assays:

  • T cell activation assays measuring proliferation and cytokine production in cells expressing wild-type vs. variant IRF2BP2

  • Macrophage polarization assays to assess the impact on M1/M2 differentiation, given IRF2BP2's role in promoting anti-inflammatory M2 phenotypes

  • B cell differentiation and antibody production assays, relevant to the CVID phenotype associated with IRF2BP2 deficiency

• CRISPR-based modeling:

  • Introduction of specific variants into relevant cell lines using CRISPR-Cas9 base editing

  • Rescue experiments expressing wild-type IRF2BP2 in cells with the variant to confirm causality

• Patient-derived cell studies:

  • Analysis of primary cells from patients carrying the variant

  • Comparison of immunological parameters with those of healthy controls and patients with known pathogenic IRF2BP2 variants

  • Ex vivo stimulation assays to assess cellular responses to various stimuli

These functional assays provide comprehensive evidence for variant pathogenicity and insight into the mechanisms by which specific IRF2BP2 variants cause disease.

What control proteins and antibodies are recommended for IRF2BP2 research?

For rigorous IRF2BP2 research, the following control proteins and antibodies are recommended:

Control proteins for interaction studies:

• Positive interaction controls:

  • NFAT1: As a well-established interaction partner, recombinant NFAT1 protein can serve as a positive control for IRF2BP2 binding assays

  • IRF2: The original binding partner of IRF2BP2, useful for validating protein functionality

  • ATF7/JDP2 heterodimer: Recently identified interaction partners in AML cells

• Negative controls:

  • Other NFAT family members (NFAT2-4): These do not interact with IRF2BP2 and serve as specificity controls

  • Truncated IRF2BP2 lacking zinc finger or RING domains: These domains are essential for IRF2BP2 function and protein interactions

Antibodies for detection and immunoprecipitation:

• Anti-IRF2BP2 antibodies:

  • Commercial antibodies against different epitopes of IRF2BP2

  • Validation of antibody specificity using IRF2BP2 knockout or knockdown samples is essential

  • For ChIP applications, ChIP-grade antibodies with validated specificity are required

• Tag-specific antibodies for recombinant proteins:

  • Anti-FLAG antibodies (such as anti-FLAG M2 affinity gel from Sigma) have been successfully used for IRF2BP2 purification

  • Anti-GST antibodies for detection of GST-tagged IRF2BP2 fragments

  • Anti-HA or anti-Myc antibodies for alternatively tagged constructs

• Control antibodies:

  • Isotype-matched IgG controls for immunoprecipitation experiments

  • Anti-GAPDH or anti-β-actin for loading controls in Western blots

  • Anti-histone H3 as a nuclear fraction control

Loading controls for subcellular fractionation:

• GAPDH or β-actin for cytoplasmic fraction

• Lamin B1 or histone H3 for nuclear fraction

• These are particularly important when studying IRF2BP2 nuclear localization, which is essential for its function

Expression constructs for functional validation:

• Wild-type IRF2BP2 expression vectors

• IRF2BP2 with mutated nuclear localization signal (NLS) as a negative control for nuclear function

• Domain deletion constructs (ΔZinc finger, ΔRING) to dissect functional domains

• NFAT1 expression constructs for co-expression studies

These controls and reagents ensure the reliability and reproducibility of IRF2BP2 research across different experimental contexts.

How can researchers design robust experiments to study IRF2BP2 in cardiac hypertrophy?

Designing robust experiments to study IRF2BP2 in cardiac hypertrophy requires careful consideration of relevant models, endpoints, and controls:

• In vitro cardiomyocyte models:

  • Primary neonatal rat ventricular myocytes (NRVMs) or human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs)

  • Induce hypertrophy using established stimuli (e.g., phenylephrine, angiotensin II, or endothelin-1)

  • Manipulate IRF2BP2 expression using:

    • siRNA/shRNA knockdown

    • CRISPR/Cas9 knockout

    • Adenoviral/lentiviral overexpression

  • Measure hypertrophic responses:

    • Cell size measurement (immunofluorescence imaging)

    • Hypertrophic gene expression (ANF, BNP, β-MHC by qRT-PCR)

    • Protein synthesis rate ([³H]-leucine incorporation)

    • Sarcomere organization (α-actinin staining)

• In vivo mouse models:

  • Utilize the conditional Irf2bp2 knockout and transgenic mouse lines that have been successfully developed

  • Use cardiac-specific promoters (e.g., α-MHC-Cre) for tissue-specific manipulation

  • Induce hypertrophy through:

    • Pressure overload (transverse aortic constriction)

    • Neurohormonal stimulation (angiotensin II or isoproterenol infusion)

    • Exercise training (for physiological hypertrophy comparison)

  • Comprehensive phenotyping:

    • Echocardiography for cardiac structure and function

    • Histological analysis (H&E, Masson's trichrome for fibrosis)

    • Cardiomyocyte size measurement

    • Molecular markers of hypertrophy

    • Heart weight to body weight or tibia length ratios

• Molecular mechanism investigations:

  • ChIP-seq to identify IRF2BP2 and NFAT1 binding sites in the hypertrophic heart

  • RNA-seq to define the IRF2BP2-regulated transcriptome in normal vs. hypertrophied hearts

  • Co-immunoprecipitation to assess IRF2BP2-NFAT1 interaction dynamics during hypertrophy

  • Competition assays to demonstrate how IRF2BP2 competes with MEF2C for binding to NFAT1

  • Reporter assays using NFAT-responsive promoters to quantify repression by IRF2BP2

• Translational human studies:

  • Analyze IRF2BP2 expression in human heart samples from:

    • Patients with hypertrophic cardiomyopathy

    • Heart failure patients with or without hypertrophy

    • Non-failing control hearts

  • Correlate expression patterns with clinical parameters and outcomes

  • Screen for IRF2BP2 variants in patients with excessive hypertrophic responses

• Critical experimental controls:

  • Include time-course analyses to capture dynamic changes

  • Compare pathological vs. physiological hypertrophy responses

  • Use both gain- and loss-of-function approaches for IRF2BP2

  • Include littermate controls for genetic mouse models

  • Employ sham-operated controls for surgical interventions

  • Validate key findings across multiple experimental models

These experimental approaches build upon the established role of IRF2BP2 in regulating pathological cardiac hypertrophy and provide a comprehensive framework for advancing our understanding of its mechanisms and therapeutic potential.

What experimental strategies can elucidate the role of IRF2BP2 in inflammatory diseases?

To elucidate the role of IRF2BP2 in inflammatory diseases, researchers should implement the following experimental strategies:

• Cellular models of inflammation:

  • Macrophage polarization studies:

    • Compare M1/M2 polarization in wild-type vs. IRF2BP2-deficient macrophages

    • Assess the expression of polarization markers (M1: TNF-α, IL-1β, iNOS; M2: Arg1, IL-10, CD206)

    • Evaluate IRF2BP2's role in regulating KLF2 expression, which mediates M2 polarization

  • Microglia activation models:

    • Analyze activation patterns in IRF2BP2-deficient microglia

    • Measure inflammatory cytokine production and expression of M2 anti-inflammatory markers

  • T cell activation studies:

    • Examine how IRF2BP2 regulates cytokine production (IL-2, IL-4) in activated T cells

    • Assess T cell proliferation and differentiation patterns

• Animal models of inflammatory diseases:

  • Atherosclerosis models:

    • Use macrophage-specific IRF2BP2-deficient mice to study atherosclerosis progression, building on previous findings that these mice develop severe atherosclerosis

    • Analyze plaque composition, stability, and inflammatory cell infiltration

  • Autoimmune disease models:

    • Evaluate the impact of IRF2BP2 deficiency in models of multiple sclerosis, inflammatory bowel disease, or rheumatoid arthritis

    • Assess disease severity, inflammatory markers, and tissue pathology

  • Infection models:

    • Challenge IRF2BP2-deficient mice with viral, bacterial, or fungal pathogens

    • Monitor immune responses, pathogen clearance, and inflammatory tissue damage

• Mechanistic molecular studies:

  • Transcriptional regulation analysis:

    • Perform RNA-seq in relevant cell types with manipulated IRF2BP2 expression

    • Identify inflammation-related genes regulated by IRF2BP2

  • Epigenetic studies:

    • ChIP-seq for IRF2BP2 binding sites in inflammatory cells

    • Correlate with histone modifications and chromatin accessibility

  • Protein interaction networks:

    • Identify inflammation-specific IRF2BP2 interaction partners

    • Map how these interactions change during inflammatory activation

• Translational human studies:

  • Patient cohort analyses:

    • Screen for IRF2BP2 variants in patients with inflammatory disorders

    • Correlate genotypes with disease phenotypes and severity

  • Ex vivo studies with patient samples:

    • Compare inflammatory responses in cells from patients with IRF2BP2 variants to healthy controls

    • Assess cytokine production, cell differentiation, and signaling pathways

• Therapeutic intervention studies:

  • Test approaches to modulate IRF2BP2 activity:

    • Small molecule screening to identify compounds that enhance IRF2BP2 function

    • Evaluate the effects of IRF2BP2-enhancing compounds on inflammatory disease models

  • Gene therapy approaches:

    • Develop methods to increase IRF2BP2 expression in specific cell types

    • Test in pre-clinical models of inflammatory disease

These comprehensive strategies will provide insights into IRF2BP2's role in inflammatory disease pathogenesis and identify potential therapeutic targets for modulating inflammation through the IRF2BP2 pathway.

What are the emerging therapeutic implications of IRF2BP2 research?

IRF2BP2 research has revealed several promising therapeutic implications across multiple disease contexts:

• Cardiac hypertrophy therapeutics:

  • IRF2BP2 directly represses the NFAT1-mediated hypertrophic transcriptome, suggesting that enhancing IRF2BP2 function could mitigate pathological cardiac hypertrophy

  • Targeting NFAT1 at the effector phase of hypertrophic signaling through IRF2BP2 holds great potential for treating cardiac hypertrophy, especially given the limited pharmacological options currently available

  • Therapeutic strategies might include small molecules that enhance IRF2BP2 expression or activity, or gene therapy approaches to increase cardiac IRF2BP2 levels

• Inflammatory disease modulation:

  • IRF2BP2's role in promoting M2 macrophage polarization presents opportunities for treating inflammatory conditions

  • Enhancing IRF2BP2 function could potentially reduce atherosclerosis progression, as mice with IRF2BP2-deficient macrophages develop severe atherosclerosis

  • Targeting the IRF2BP2-KLF2 axis could provide a novel approach for modulating macrophage-driven inflammation in various diseases

• Immunodeficiency treatments:

  • Understanding the mechanisms by which IRF2BP2 haploinsufficiency leads to Common Variable Immunodeficiency (CVID) provides a foundation for targeted therapies

  • Gene replacement or enhancement strategies could potentially correct the underlying defect in patients with IRF2BP2 mutations

  • Targeting downstream pathways affected by IRF2BP2 deficiency might ameliorate specific aspects of the disease phenotype

• Cancer therapeutics:

  • The ATF7/JDP2-IRF2BP2 regulatory axis in acute myeloid leukemia (AML) represents a promising therapeutic vulnerability

  • Modulating the delicate balance of inflammatory pathways in cancer cells by targeting IRF2BP2 or its interaction partners could disrupt the pro-oncogenic environment

  • The context-dependent role of IRF2BP2 in different cancers suggests that therapeutic strategies would need to be tailored to specific tumor types

• Precision medicine approaches:

  • The identification of specific IRF2BP2 variants in patients with immunodeficiency enables genetic diagnosis and personalized treatment approaches

  • Functional characterization of novel variants can guide therapeutic decisions and prognostic assessments

  • Genotype-phenotype correlations may help predict disease manifestations and guide preventive interventions