Recombinant Human Long-chain fatty acid transport protein 6 (SLC27A6)

What is SLC27A6 and what are its primary functions in cellular metabolism?

SLC27A6, also known as FATP6 (Fatty Acid Transport Protein 6), is a member of the solute carrier family 27 that facilitates the transport of long-chain fatty acids (LCFAs) across the plasma membrane. SLC27A6 serves dual functions:

• As a fatty acid transporter that mediates LCFA uptake into cells, particularly in tissues with high energy demands

• As an acyl-CoA ligase that catalyzes the ATP-dependent formation of fatty acyl-CoA using LCFAs and very-long-chain fatty acids (VLCFAs) as substrates

SLC27A6 exhibits preferential transport activity for palmitic acid (C16:0) and displays weak very-long-chain acyl-CoA synthetase activity towards lignoceric acid (C24:0) . It also shows activity for arachidonic acid (C20:4n-6), highlighting its role in specialized fatty acid metabolism .

What is the tissue distribution pattern of SLC27A6 in humans?

SLC27A6 displays a distinctive tissue expression pattern:

• Predominantly expressed in the heart, specifically in the sarcolemma of cardiomyocytes and plasma membranes adjacent to blood vessels

• Colocalizes with CD36 (another fatty acid transport protein) in cardiac tissue

• Expression detected in skin and hair follicle epithelia

• Present in human trophoblasts from the placenta

• Very low expression in brain tissue

This expression pattern suggests SLC27A6 plays a crucial role in tissues with high fatty acid utilization rates, particularly in the heart where it regulates LCFA uptake for energy production.

What are the recommended methods for analyzing SLC27A6 expression in tissue samples?

For accurate analysis of SLC27A6 expression in tissue samples, researchers should employ the following methodological approaches:

RNA Expression Analysis:

• Quantitative real-time PCR (qRT-PCR) using validated primer pairs:

  • Forward primer: CTTCTGTCATGGCTAACAGTTCT

  • Reverse primer: [Paired reverse primer from referenced sequences]

• RNA extraction protocols should be tissue-specific (e.g., RNeasy Lipid Tissue Mini Kit for lipid-rich samples)

• Normalize expression to stable reference genes such as GAPDH

Protein Expression Analysis:

• Western blotting using validated antibodies (e.g., ab167099 at 1 μg/mL concentration)

• Immunohistochemistry (IHC) with appropriate fixation and antigen retrieval protocols for membrane proteins

Statistical Analysis:

• For non-normally distributed data, use non-parametric tests (e.g., Wilcoxon's signed-rank tests)

• For correlation analyses, apply Spearman rank correlation coefficients

It's important to note that SLC27A6 expression can vary significantly between tumoral and non-tumoral tissues, requiring careful sample selection and matched controls .

What approaches are effective for modulating SLC27A6 expression in cell culture systems?

Multiple validated approaches can be employed to modulate SLC27A6 expression in experimental settings:

Overexpression Systems:

• Stable transfection using plasmids containing SLC27A6 ORF cDNA (e.g., pCMV6-entry vector)

• Selection with appropriate antibiotics (e.g., G418 at 200-600 μg/mL for 2 weeks)

• Validation of overexpression by qRT-PCR and western blotting

Knockdown/Silencing Approaches:

• Lentiviral shRNA transfection targeting SLC27A6

• Maintain cells with puromycin (2 μg/mL) for 3-6 generations post-infection

• Polybrene (8 μg/ml) can improve infection efficiency

Demethylation Treatment:

• 5-aza-2'-deoxycytidine (5-aza-dC) treatment at 5 μM for 4 days to reverse DNA methylation-induced silencing

• Media containing 5-aza-dC should be refreshed every 24 hours

Expression modulation should be verified using multiple detection methods before proceeding with functional studies.

How can I assess the fatty acid transport activity of SLC27A6 in cell-based systems?

To evaluate SLC27A6-mediated fatty acid transport activity, researchers can implement the following methodological approaches:

Lipid Uptake Assays:

• BODIPY-labeled fatty acid analogues can be used with flow cytometry to quantify intracellular lipid accumulation

• Fluorescence microscopy to visualize lipid droplet formation in SLC27A6-expressing versus control cells

Metabolic Parameter Measurements:

• Flow cytometry-based assays to quantify triglycerides (TG) and total cholesterol (T-CHO) levels

• Comparative analysis of lipid content between SLC27A6-overexpressing and control cells

High-Throughput Screening Approaches:

• 96-well fluorometric imaging plate reader (FLIPR) assays using stably expressing cell lines

• Signal-to-background ratios between 3 and 5-fold can be achieved with optimized protocols

Treatment with Fatty Acid Substrates:

• Oleic acid treatment (30-45 μM) to evaluate SLC27A6-dependent changes in lipid metabolism

• Measure subsequent effects on cell proliferation using viability assays like CCK-8

When implementing these assays, researchers should include appropriate controls and consider the impact of endogenous fatty acid transporters that may be expressed in the chosen cell system.

What cellular phenotypes are associated with SLC27A6 modulation in different experimental contexts?

SLC27A6 modulation has been associated with distinct and sometimes contradictory cellular phenotypes, depending on the experimental context:

Effects on Cell Proliferation:

• In nasopharyngeal carcinoma (NPC) cells, SLC27A6 overexpression significantly suppresses cell proliferation and colony formation capacity

  • Reduction to 44-55% of control cell colony formation rates

  • Decreased expression of proliferation marker Ki-67 in xenograft tumors

• In non-tumorigenic breast cells (H184B5F5/M10), SLC27A6 silencing inhibits cell proliferation and delays cell cycle progression

  • Decreased expression of cell cycle regulators CDK4, CDK6, and cyclin D1

Effects on Cell Migration and Invasion:

• SLC27A6 overexpression promotes wound closure, migration, and invasion in NPC cells

  • In HONE1 cells: 77% gap closure with SLC27A6 overexpression vs. 40% in control cells

  • In 5-8F cells: 35% gap closure with SLC27A6 overexpression vs. 8% in control cells

• Enhanced invasion capabilities through Matrigel-coated chambers

Effects on EMT and Metastatic Potential:

• SLC27A6 overexpression induces epithelial-mesenchymal transition (EMT) markers in xenografts

  • Suppression of epithelial marker E-cadherin

  • Increased expression of EMT transcription factor Snail

  • Enhanced β-catenin signaling

Impact on Tumor Growth In Vivo:

• Xenograft models showed reduced tumorigenicity (71.4% vs. 100% in controls) and smaller tumor size with SLC27A6 overexpression

These contextual differences highlight the complex role of SLC27A6 in cellular processes and underscore the importance of experimental design in studying its functions.

How is SLC27A6 expression regulated in cancer, and what mechanisms are responsible for observed expression changes?

SLC27A6 expression shows complex patterns of dysregulation across different cancer types, with distinct regulatory mechanisms:

Epigenetic Regulation:

• DNA promoter CpG island hypermethylation silences SLC27A6 expression in nasopharyngeal carcinoma (NPC)

  • Treatment with demethylation agent 5-aza-dC restores SLC27A6 expression by 5-7 fold in NPC cell lines

  • This suggests epigenetic silencing as a key mechanism for SLC27A6 downregulation in NPC

Expression Patterns in Different Cancers:

• Downregulated in:

  • Nasopharyngeal carcinoma

  • Esophageal squamous cell carcinoma

  • Breast cancer

  • Glioblastoma tumors compared to peritumoral areas

• Upregulated in:

  • Papillary thyroid carcinoma (considered an invasive biomarker)

  • Enzalutamide-resistant prostate cancer

Statistical Evidence from Meta-Analysis:

• Meta-analysis of six microarray datasets (114 NPC and 46 non-tumor samples) showed significant downregulation of SLC27A6 in NPC

  • Pooled Standard Mean Difference (SMD): -1.67 (95% CI: -2.38, -0.97)

  • Significant heterogeneity observed (I² = 56.0%, p < 0.05)

Clinical Correlations:

These findings suggest that SLC27A6 may function as a context-dependent regulator in cancer progression, with its expression regulated through multiple mechanisms, particularly epigenetic modifications.

What experimental approaches should be used to investigate the seemingly contradictory roles of SLC27A6 in tumor progression?

To address the paradoxical functions of SLC27A6 in tumor biology, researchers should implement comprehensive experimental strategies:

Contextual Analysis Across Multiple Cancer Types:

• Perform parallel studies in different cancer cell lines representing diverse tissue origins

• Compare effects in tumorigenic vs. non-tumorigenic cell lines from the same tissue (e.g., HONE1 vs. CNE1 for NPC, Hs578T vs. H184B5F5/M10 for breast)

Integrated Multi-Omics Approach:

• Combine transcriptomics, proteomics, and metabolomics analyses to identify context-specific pathways

• Utilize protein-protein interaction networks via tools like STRING to identify SLC27A6-associated proteins involved in:

  • Lipid biosynthesis

  • Fatty acid metabolic processes

  • Fatty acid transport

Temporal Studies:

• Analyze both immediate and long-term consequences of SLC27A6 modulation

• Implement inducible expression systems to control timing of SLC27A6 expression changes

Metabolic Profiling:

• Measure effects on:

  • Intracellular triglycerides, lactic acid, and citric acid content

  • Expression of lipogenic enzymes (FASN, ACC)

  • Fatty acid uptake capacity

Combined In Vitro and In Vivo Approaches:

• Parallel assessment of:

  • Cell proliferation (CCK-8 assay)

  • Colony formation capacity

  • Migration (wound-healing assay)

  • Invasion (transwell assay with gel-coating)

  • Xenograft tumor growth and metastasis formation

Pathway-Specific Perturbations:

• Examine interactions with known oncogenic pathways:

  • Cell cycle regulation (CDK4, CDK6, cyclin D1)

  • EMT signaling (E-cadherin, Snail, β-catenin)

  • Apoptotic response (BAX expression)

Genomic Modification Techniques:

• CRISPR-Cas9 to create precise gene knockouts

• Site-directed mutagenesis to identify functional domains responsible for opposing effects

By implementing these complementary approaches, researchers can better elucidate the context-dependent functions of SLC27A6 and resolve apparent contradictions in its roles across different cancer types and cellular processes.

How can the functionality of recombinant SLC27A6 be verified in membrane-based systems?

Verifying the functionality of recombinant SLC27A6 requires specialized assays that assess both transport and enzymatic activities:

Transport Activity Assays:

• Reconstitution into liposomes or proteoliposomes to measure substrate transport

• Fluorescent fatty acid analogue (e.g., BODIPY-labeled fatty acids) uptake measured by:

  • Fluorescence spectroscopy to track transport kinetics

  • Flow cytometry to quantify cellular uptake in intact cells

• Radioisotope-labeled fatty acids (e.g., [14C]-palmitate) to measure transport rates with high sensitivity

Enzymatic Activity Assessment:

• Acyl-CoA synthetase activity measurement:

  • ATP-dependent formation of fatty acyl-CoA

  • Specific activity towards preferred substrates (palmitic acid C16:0, arachidonic acid C20:4n-6)

• Coupled enzyme assays to detect AMP formation as a product of the reaction

Substrate Specificity Profiling:

• Competitive inhibition assays with different fatty acid species

• Determine kinetic parameters (Km, Vmax) for various substrates

• Assess activity towards very-long-chain fatty acids (VLCFAs) and lignoceric acid (C24:0)

Inhibitor Studies:

• Screen specific inhibitors to confirm target engagement

• Dose-response curves to determine IC50 values

• Reversibility testing of inhibition

Biophysical Characterization:

• Thermal shift assays to assess protein stability

• Surface plasmon resonance (SPR) to measure substrate binding kinetics

• Hydrogen-deuterium exchange mass spectrometry to probe conformational changes

These methodological approaches provide comprehensive validation of recombinant SLC27A6 functionality, ensuring that the protein maintains both its transport and enzymatic activities in experimental systems.

What is the role of SLC27A6 in metabolic reprogramming during cancer progression?

SLC27A6's involvement in cancer metabolic reprogramming represents a complex and emerging area of research:

Lipid Metabolism Alterations:

• SLC27A6 overexpression in NPC cells leads to:

  • Increased lipid droplet (LD) formation in the cytoplasm

  • Higher intracellular triglyceride (TG) and total cholesterol (T-CHO) levels

  • Enhanced lipid metabolism correlated with altered tumor progression phenotypes

Impact on Tumor Cell Bioenergetics:

• SLC27A6 silencing in enzalutamide-resistant prostate cancer cells affects:

  • Intracellular triglyceride content

  • Lactic acid and citric acid levels

  • Expression of lipogenic enzymes (FASN and ACC)

Context-Dependent Effects:

• In non-tumorigenic breast cells:

  • SLC27A6 silencing inhibits fatty acid uptake capacity

  • Disruption of lipid metabolism correlates with reduced cell proliferation

• In tumorigenic breast cancer cells:

  • SLC27A6 silencing has minimal effect on lipid metabolism

  • Suggests differential metabolic dependencies between normal and cancer cells

Connections to EMT and Metastasis:

• Increased lipid turnover appears linked to enhanced migration and invasion

• SLC27A6-mediated lipid accumulation correlates with EMT marker expression in NPC

• This suggests fatty acid metabolism may fuel metastatic processes in certain contexts

Relationship with Therapeutic Resistance:

• SLC27A6 expression is highly increased in enzalutamide-resistant prostate cancer

• Knockdown of SLC27A6 affects expression of cell cycle regulators and pro-apoptotic proteins

Future research should focus on elucidating the precise mechanisms by which SLC27A6-mediated fatty acid transport and metabolism contribute to cancer-specific metabolic reprogramming and how these alterations influence tumor progression and therapeutic response.

How does the interplay between SLC27A6 and other fatty acid transporters affect cellular metabolism?

The functional interplay between SLC27A6 and other fatty acid transport systems represents a complex regulatory network:

Coordinated Expression Patterns:

• SLC27A6 colocalizes with CD36 (another fatty acid transporter) in cardiac tissue

• Expression correlation analysis with other SLC27 family members:

  • Positive correlation between SLC27A4, SLC27A5, and SLC27A6 expression observed in specific contexts

  • Expression of SLC27A1 and SLC27A3 positively correlates with ELOVL6 (involved in fatty acid elongation)

Functional Cooperation:

• CD36, associated with lipid rafts, may hand LCFAs directly to SLC27A6 for transport across the plasma membrane

• This suggests a coordinated "hand-off" mechanism between plasma membrane-associated transport proteins

Compensatory Mechanisms:

• In glioblastoma, reduced expression of SLC27A4 and SLC27A6 compared to peritumoral areas suggests coordinated dysregulation

• Differential expression of SLC27 family members across various cancer types may represent compensatory adaptations

Metabolic Context Dependency:

Therapeutic Implications:

• Inhibitor specificity is crucial when targeting fatty acid transport:

  • Compounds that inhibit one FATP may have decreased effectiveness in tissues expressing multiple transporters

  • High-throughput screening approaches have identified FATP-specific inhibitors that don't affect other transport systems

Understanding these complex interrelationships is essential for developing targeted approaches to modulate fatty acid metabolism in both physiological and pathological contexts.

What genetic and epigenetic factors regulate SLC27A6 expression in different physiological and pathological conditions?

The regulation of SLC27A6 involves complex genetic and epigenetic mechanisms that vary across physiological states and disease conditions:

Epigenetic Regulation:

• DNA methylation:

  • Promoter CpG island hypermethylation silences SLC27A6 in nasopharyngeal carcinoma

  • Demethylation treatment with 5-aza-dC restores expression by 5-7 fold in NPC cell lines

  • The methylation status correlates with expression level across multiple cancer types

Genetic Polymorphisms:

• A T>A polymorphism within the 5' UTR of SLC27A6 has been associated with:

  • Lower fasting and fed triacylglycerides

  • Reduced blood pressure

  • Decreased left ventricular hypertrophy

  • Potential protective effect against cardio-metabolic diseases

Tissue-Specific Expression Factors:

• SLC27A6 expression is very low in brain tissue but high in cardiac tissue

• Expression correlates with tissue-specific energy demands and fatty acid utilization patterns

Sex-Specific Regulation:

Environmental Factors:

• Smoking history correlates with altered SLC27A6 expression in a sex-dependent manner

• Body mass index (BMI) negatively correlates with SLC27A expression in men

Disease-Related Changes:

• Differential expression observed across cancer stages and subtypes

• Expression patterns vary significantly between tumoral and non-tumoral tissues

Future research should focus on elucidating the specific transcription factors and regulatory elements controlling SLC27A6 expression in different contexts, as well as how these regulatory mechanisms are altered in disease states.

What cutting-edge technologies are being applied to advance SLC27A6 research?

Recent technological advances are transforming SLC27A6 research approaches:

High-Throughput Screening Technologies:

• Fluorometric imaging plate reader (FLIPR) assays in 96-well format for screening potential SLC27A6 modulators

• Development of cell-based assays that can detect signal-to-background ratios between 3-5 fold

• These methods facilitate rapid identification of selective inhibitors for fatty acid transport proteins

Advanced Genomic Engineering:

• CRISPR-Cas9 technology allows precise genetic manipulation of SLC27A6 in cellular models

• Base editing and prime editing techniques can introduce specific polymorphisms (e.g., the T>A polymorphism in the 5' UTR)

• Creation of conditional knockout models to study tissue-specific functions

Multi-Omics Integration:

• Combining transcriptomics, proteomics, and metabolomics data to understand SLC27A6 in broader metabolic networks

• Bioinformatic approaches using databases like STRING to identify protein-protein interaction networks

• Meta-analysis of multiple datasets to detect consistent expression patterns across studies

Advanced Microscopy Techniques:

• Super-resolution microscopy to visualize SLC27A6 localization and trafficking

• Live-cell imaging with fluorescent fatty acid analogues to track real-time transport dynamics

• FRET-based biosensors to detect protein-protein interactions involving SLC27A6

Computational Modeling:

• Structural prediction of SLC27A6 using AlphaFold or similar AI-based approaches

• Molecular dynamics simulations to understand transport mechanisms

• Systems biology modeling of fatty acid transport and metabolism networks

Translational Research Tools:

• Patient-derived organoids to study SLC27A6 function in disease-relevant contexts

• Development of biomarkers based on SLC27A6 expression or activity

• Therapeutic targeting strategies based on selective modulation of fatty acid transport

These emerging technologies are enabling deeper insights into SLC27A6 function and opening new avenues for therapeutic intervention in diseases involving dysregulated fatty acid metabolism.

What are the most promising therapeutic applications targeting SLC27A6 function?

Emerging research suggests several potential therapeutic applications targeting SLC27A6:

Cardio-Metabolic Disease:

• The identified T>A polymorphism in SLC27A6's 5' UTR associated with lower triglycerides and blood pressure suggests SLC27A6 inhibition might protect against cardiovascular disease

• Modulation of cardiac fatty acid uptake through SLC27A6 could influence energy metabolism in heart failure

Cancer Therapy:

• Dual targeting approaches based on SLC27A6's context-dependent roles:

  • In tumors where SLC27A6 is downregulated (e.g., NPC, breast cancer), restoration of expression might suppress proliferation

  • In contexts where SLC27A6 promotes metastasis, selective inhibition might reduce invasion and EMT

Metabolic Reprogramming:

• Targeting SLC27A6 to disrupt lipid metabolism in therapy-resistant cancers:

  • Knockdown of SLC27A6 affects lipogenic enzymes and metabolite levels in enzalutamide-resistant prostate cancer

  • Combined targeting with anti-cancer drugs might overcome resistance mechanisms

Selective Inhibitor Development:

• High-throughput screening approaches have successfully identified selective inhibitors for related FATP proteins

• Similar approaches could yield SLC27A6-specific compounds with limited off-target effects

Biomarker Applications:

• SLC27A6 expression levels could serve as prognostic biomarkers in certain cancers

• Higher expression correlates with better survival in breast cancer patients

Precision Medicine Approaches:

• Genotyping SLC27A6 polymorphisms might identify patients who would benefit from specific therapeutic interventions

• Epigenetic profiling of the SLC27A6 promoter could guide use of demethylating agents in certain cancers

These therapeutic applications remain in early research stages, but represent promising directions for clinical translation as our understanding of SLC27A6 biology continues to evolve.

What are the key technical challenges in studying SLC27A6 and how can they be addressed?

Researchers face several significant technical challenges when studying SLC27A6:

Membrane Protein Expression and Purification:

• Challenge: As a transmembrane protein, SLC27A6 is difficult to express and purify in functional form

• Solutions:

  • Optimize detergent screening protocols to identify conditions that maintain protein stability

  • Consider fusion tags that enhance solubility while preserving function

  • Explore nanodiscs or proteoliposomes for functional reconstitution

Functional Assay Limitations:

• Challenge: Distinguishing SLC27A6-specific transport from other endogenous fatty acid transporters

• Solutions:

  • Use cell lines with minimal expression of other fatty acid transporters

  • Employ selective inhibitors for other transport systems when available

  • Design CRISPR knockout models lacking other major fatty acid transporters

Antibody Specificity Issues:

• Challenge: Limited availability of highly specific antibodies for SLC27A6

• Solutions:

  • Validate antibodies across multiple detection methods (Western blot, IHC, flow cytometry)

  • Include appropriate positive and negative controls in all experiments

  • Consider epitope tagging of recombinant proteins when studying in cellular systems

Contradictory Phenotypic Effects:

• Challenge: Resolving opposing effects of SLC27A6 on proliferation versus migration

• Solutions:

  • Design temporal studies to separate immediate versus long-term effects

  • Investigate pathway-specific effects using targeted inhibitors

  • Analyze context-dependent protein interactions that might explain divergent functions

Tissue-Specific Expression Patterns:

• Challenge: Limited expression in certain tissues complicates detection and functional analysis

• Solutions:

  • Use highly sensitive detection methods (droplet digital PCR, RNAscope)

  • Develop tissue-specific models that conditionally overexpress SLC27A6

  • Consider single-cell approaches to identify specific cell populations expressing SLC27A6

Methodological Standardization:

• Challenge: Variability in experimental approaches complicates cross-study comparisons

• Solutions:

  • Establish standardized protocols for expression analysis and functional assays

  • Report detailed methodological parameters in publications

  • Participate in collaborative initiatives to establish reference standards

Addressing these technical challenges will significantly advance our understanding of SLC27A6 biology and its potential therapeutic applications.

How should researchers interpret contradictory findings regarding SLC27A6 function across different experimental systems?

When faced with seemingly contradictory findings about SLC27A6 function, researchers should consider the following interpretative framework:

Contextual Dependencies:

• SLC27A6 functions differently in various cellular contexts:

  • Suppresses proliferation in NPC cells but enhances migration and invasion

  • Its silencing inhibits proliferation in non-tumorigenic breast cells but has minimal effect in tumorigenic breast cancer cells

• Interpretation approach: Systematically document cell type, tissue origin, and disease state for each experimental system

Methodological Variations:

• Differences in:

  • Expression level and duration (transient vs. stable)

  • Assay timing (immediate vs. long-term effects)

  • Detection methods (direct vs. indirect measurement)

• Interpretation approach: Carefully review methodological details and standardize protocols where possible

Pathway Crosstalk:

• SLC27A6 interacts with multiple pathways:

  • Lipid metabolism (FASN, ACC)

  • Cell cycle regulation (CDK4, CDK6, cyclin D1)

  • EMT signaling (E-cadherin, Snail, β-catenin)

• Interpretation approach: Perform pathway inhibition studies to isolate specific effects

Genetic Background Influences:

• Differences in:

  • Endogenous expression of other SLC27 family members

  • Metabolic status and substrate availability

  • Genetic alterations affecting downstream pathways

• Interpretation approach: Characterize genetic background thoroughly and use isogenic cell lines when possible

Temporal Dynamics:

• SLC27A6 may have:

  • Initial effects on certain pathways (e.g., cell cycle)

  • Delayed effects on others (e.g., EMT programming)

• Interpretation approach: Design time-course experiments to capture dynamic changes

Data Integration Strategy:

• Document all experimental conditions systematically

• Identify consistent findings across multiple systems

• Map context-specific effects to particular pathways or conditions

• Develop testable hypotheses to explain divergent results

• Design experiments specifically addressing contradictions