Recombinant Human Mitochondrial import inner membrane translocase subunit TIM50 (TIMM50)

What is the primary function of TIMM50 in mitochondrial protein import?

TIMM50 functions as the receptor component of the TIM23 complex in the mitochondrial inner membrane. It recognizes both types of TIM23 substrates: proteins destined for the matrix and those targeted to the inner membrane. TIMM50 is critically positioned in the intermembrane space (IMS) where it facilitates the transfer of precursor proteins from the translocase of the outer membrane (TOM complex) to the TIM23 complex . This function depends on its association with TIM23, as together they coordinate the actions of translocators and motor proteins required for efficient mitochondrial protein import . Studies have shown that TIMM50 specifically recognizes presequence-containing proteins, as demonstrated by crosslinking experiments with matrix-targeted precursors like Jac1 and inner membrane proteins such as Oxa1 .

What is the structural organization of TIMM50?

TIMM50 contains several distinct domains with specific functions:

• N-terminal mitochondrial targeting sequence

• Transmembrane domain (TMD) that anchors it to the inner membrane

• Large intermembrane space (IMS) domain that interacts with precursor proteins and TIM23

The crystal structure of the IMS domain of TIMM50 (residues 176-361) has been determined at 1.83 Å resolution . This domain contains a large groove that serves as a putative binding site for presequences. The structure was solved in space group P6₁22 with cell dimensions a=84.109 Å and c=116.549 Å . The final model was refined with an R-factor of 19.3% and R-free of 22.4%, with excellent geometry (98.3% of residues in favored regions of the Ramachandran plot) .

How can researchers effectively knockdown or knockout TIMM50 for functional studies?

TIMM50 knockout/knockdown studies require careful consideration because both under- and over-expression can affect cellular fitness . For generating global TIMM50 knockout mice, the CRISPR-Cas9 technique has been successfully employed . The following methodology has been validated:

• Use online CRISPR design tools (e.g., http://crispr.mit.edu) to predict guide sequences targeting the mouse TIMM50 gene

• Design and anneal oligomers (reported successful sequences: oligo1: TAGGCCTTGGAGCCCCCACGGT and oligo2: AAACACCGTGGGGGCTCCAAGG)

• Clone the annealed oligomers into an sgRNA expression vector (e.g., pUC57-sgRNA)

• Transcribe sgRNA and Cas9 using appropriate kits (MEGAshortscript Kit and T7 Ultra Kit, respectively)

• Micro-inject Cas9 and sgRNA mRNA into single-cell embryos

• Confirm knockouts using PCR analysis with specific primers (e.g., TIM50-238-F: 5′-CTGGATGTCCACTTCCTGGT-3′)

For knockdown studies in protists like T. brucei, RNA interference approaches have been effective, though tight control of expression levels is crucial due to cellular fitness effects .

What are the non-canonical functions of TIMM50 beyond protein import?

TIMM50 exhibits diverse functions beyond its canonical role in protein import, making it a multifunctional protein with significant implications for various cellular processes:

• Apoptosis regulation: TIMM50 levels directly influence apoptotic pathways. Both depletion and overexpression of TIMM50 can trigger apoptosis, albeit through different mechanisms. TIMM50 depletion decreases mitochondrial membrane potential and accelerates cytochrome C release, while overexpression increases membrane potential but can still induce apoptosis (suppressible by co-expression of anti-apoptotic protein p35) .

• Development and growth: TIMM50 plays crucial roles in organismal development. In zebrafish embryos, downregulation of TIMM50 by antisense RNA causes neurodegeneration, dysmorphic heart features, and reduced motility due to apoptosis . In Drosophila, Tim50 mutations result in tiny flies, indicating its importance in growth and development .

• Cardiac function: TIMM50 acts as a protective regulator against pathological cardiac hypertrophy. It is downregulated in both human dilated cardiomyopathy hearts and hypertrophic murine hearts. TIMM50-deficient mice exhibit more severe cardiac hypertrophy than wild-type mice, while cardiac-specific overexpression demonstrates a protective effect . Mechanistically, TIMM50 regulates cardiac hypertrophy by reducing reactive oxygen species (ROS) accumulation and ASK1 activity .

• Cancer cell growth: TIMM50 levels correlate with the growth and proliferation of various cancer cell types, suggesting potential roles in cancer biology .

How do TIMM50 mutations affect mitochondrial function and disease phenotypes?

TIMM50 mutations have been linked to severe human diseases, particularly in the nervous system. A pediatric case study identified compound heterozygous pathogenic mutations in TIMM50 (335C>A, resulting in S112* truncation, and 569G>C, resulting in G190A in the transmembrane domain) in a patient with rapidly progressing severe encephalopathy with elevated lactate levels . The patient died of cardiorespiratory arrest at 32 months of age.

These mutations cause multiple mitochondrial dysfunctions:

• Reduced levels of TIMM50 and other TIM23 complex components (TIMM17A, TIMM17B, TIMM23, DNAJC19)

• Moderately reduced mitochondrial membrane potential

• Increased reactive oxygen species (ROS) levels

• Elevated SOD2 and ACO2 expression as compensatory mechanisms

• Reduced import of specific nuclear-encoded mitochondrial proteins (e.g., TFAM), while import of others (e.g., AAC1) remained unaffected

• Lower respiration rate, particularly respiration coupled with ATP production

• Enhanced autophagic response (upregulated VDAC1 and LC3 with reduced p62)

Notably, expression of wild-type TIMM50 in the patient's fibroblasts reversed most of these defects, confirming the direct link between TIMM50 dysfunction and the observed phenotypes .

What methodologies are most effective for studying TIMM50-dependent protein import in vitro?

Several validated methodologies have proven effective for investigating TIMM50's role in protein import:

• Co-immunoprecipitation assays: Overexpressing HA-tagged TIMM50 in organisms like T. brucei allows co-immunoprecipitation of interaction partners (e.g., TbTim17) from mitochondrial lysates .

• Yeast two-hybrid analysis: This technique has successfully demonstrated direct interaction between TIMM50 and other TIM complex components like TIM23 .

• In vitro protein import assays: These assays can determine the impact of TIMM50 knockdown on import efficiency of different mitochondrial proteins. Particularly useful for distinguishing between N-terminal signal-containing and internal signal-containing nuclear-encoded mitochondrial proteins .

• Cross-linking experiments: This approach identifies transient interactions between TIMM50 and translocating precursors. Precursors arrested in the TOM complex can be cross-linked to TIMM50, demonstrating its proximity to the TOM complex and its role in recognizing incoming precursors . Specific precursors successfully used in such studies include matrix-targeted proteins (b2-DHFR, Jac1) and inner membrane proteins (Oxa1, Rieske FeS protein) .

• Membrane potential measurements: Since TIMM50 affects mitochondrial membrane potential, techniques to measure this parameter (e.g., potentiometric dyes) provide important functional data .

How does the Tim23-Tim50 interaction coordinate protein translocation across mitochondrial membranes?

The Tim23-Tim50 pair serves as a critical functional unit that coordinates multiple aspects of protein import:

• Precursor transfer from TOM to TIM23: Tim23 and Tim50 interact in the intermembrane space to facilitate efficient transfer of precursor proteins from the TOM complex to the TIM23 complex . This interaction is essential, as neither protein alone can efficiently perform this transfer function.

• Presequence recognition: Tim50 contains a large groove in its IMS domain that serves as a putative binding site for presequences . It recognizes both matrix-targeted precursors and inner membrane proteins containing N-terminal presequences .

• Motor protein coordination: Beyond just passing precursors from TOM to TIM23, the Tim23-Tim50 pair also facilitates a late step of protein translocation across the inner membrane by promoting motor functions of mitochondrial Hsp70 in the matrix .

• Complex assembly: Tim50 is recruited to the TIM23 complex primarily via its interaction with Tim23. This interaction is essentially independent of the rest of the translocase components, suggesting it forms a stable subcomplex within the larger TIM23 complex .

• Maintenance of the permeability barrier: Together, these proteins help maintain the permeability barrier of the mitochondrial inner membrane, as demonstrated by membrane potential changes when their levels are altered .

What are the current technical challenges in studying TIMM50 structure-function relationships?

Researchers face several technical challenges when investigating TIMM50:

• Expression level control: Both under- and overexpression of TIMM50 result in loss of cellular fitness and affect multiple cellular processes beyond protein import . This makes it difficult to study TIMM50 function in isolation without triggering secondary effects.

• Structural complexity: While the crystal structure of the IMS domain has been determined , the complete structure including the transmembrane domain remains challenging to resolve due to technical difficulties associated with membrane protein crystallography.

• Model organism differences: TIMM50 functions within the context of the TIM23 complex, which shows variations across different organisms. For example, TbTim50 in T. brucei functions in a divergent translocase complex , making it difficult to generalize findings across species.

• Disease-causing mutations: Understanding how different mutations affect TIMM50 function requires complex experimental setups that can differentiate between direct effects on protein import and secondary consequences on mitochondrial function .

• Functional redundancy: Potential overlapping functions with other mitochondrial components may mask some phenotypes in knockdown/knockout studies, requiring careful experimental design and interpretation.