Recombinant Human Mitoferrin-2 (SLC25A28)

What is the primary function of Mitoferrin-2 (SLC25A28) in human cells?

Mitoferrin-2 (SLC25A28) functions as a mitochondrial iron transporter implicated in transferring iron into mitochondria. This iron is utilized for essential anabolic processes, particularly iron-sulfur cluster (ISC) synthesis . The protein is located in the mitochondrial inner membrane and plays a crucial role in maintaining iron homeostasis within mitochondria. Mitoferrin-2 works alongside its paralog Mitoferrin-1 (SLC25A37) to ensure proper mitochondrial function through adequate iron supply for metabolic processes, including respiration and biosynthetic pathways dependent on iron-sulfur clusters .

How does Mitoferrin-2 differ from its paralog Mitoferrin-1?

Mitoferrin-2 (MFRN2/SLC25A28) and Mitoferrin-1 (MFRN1/SLC25A37) are paralogs that perform overlapping functions as mitochondrial iron transporters. Their key differences include:

• Genomic location: MFRN1 is located on chromosome 8p, while MFRN2 is located elsewhere in the genome .

• Expression patterns: In non-erythroid cells, Mitoferrin-2 serves as the primary iron transporter in the mitochondrial inner membrane .

• Functional redundancy: The paralogs demonstrate redundant cellular functions, with one becoming indispensable if the other's function is compromised .

• Cancer context relevance: MFRN1 expression can be impaired as a result of chromosome 8p deletions, making MFRN2 essential in these contexts .

This paralog relationship creates a vulnerability that can be exploited therapeutically, particularly in cancers with chromosome 8p deletions .

What experimental methods are commonly used to measure Mitoferrin-2 expression levels?

Several methodologies can be employed to quantify Mitoferrin-2 expression in research settings:

• Quantitative Reverse Transcription PCR (qRT-PCR): This method allows for measurement of MFRN2 mRNA levels. The following primers have been validated for MFRN2 detection:

  • Forward primer: TCGTCAAGCAGAGGATGCAGAT

  • Reverse primer: GTTAAAGTGCTCTTGCAGGAAC

• Immunoblotting (Western Blot): For protein level detection, standard immunoblotting protocols can be used with commercially available anti-MFRN2 antibodies .

• Immunofluorescence: This technique enables visualization of the subcellular localization of MFRN2 within mitochondria, often employing mitochondrial co-staining markers .

When conducting these analyses, it is important to include appropriate controls and to normalize expression data to established housekeeping genes or proteins to ensure reliable quantification.

How can researchers effectively knockdown or knockout Mitoferrin-2 in experimental systems?

Researchers have successfully employed several approaches to modulate Mitoferrin-2 expression in cellular models:

• RNA interference (RNAi) knockdown: Short hairpin RNA (shRNA) constructs targeting MFRN2 have been effectively used in cell lines, often with doxycycline-inducible systems allowing for controlled expression modulation .

• CRISPR/Cas9-mediated gene knockout: This approach enables complete elimination of MFRN2 expression through targeted genetic editing. Specific sgRNA designs targeting MFRN2 have been validated in multiple studies .

For optimal experimental design:

• Include non-targeting controls (shRNA targeting Renilla luciferase or non-targeting sgRNA)

• For inducible systems, use doxycycline (1 μg/mL) changed every 48 hours

• Validate knockdown/knockout efficiency using both qRT-PCR and immunoblotting

• Consider the timing of experiments, as phenotype manifestation may take several days following MFRN2 depletion

What is the mechanism behind synthetic lethality between Mitoferrin-1 and Mitoferrin-2 in chromosome 8p-deleted cancers?

The synthetic lethality between Mitoferrin-1 (MFRN1) and Mitoferrin-2 (MFRN2) in chromosome 8p-deleted cancers operates through a paralog buffering mechanism that affects mitochondrial iron metabolism. The mechanistic basis includes:

• Paralog redundancy disruption: MFRN1 and MFRN2 perform redundant functions in mitochondrial iron transport. When chromosome 8p is deleted in cancer cells, MFRN1 expression is reduced, making cells critically dependent on MFRN2 function .

• Iron-sulfur cluster synthesis impairment: When both MFRN1 and MFRN2 are compromised, mitochondria cannot import sufficient iron for iron-sulfur cluster synthesis, which are critical for multiple cellular processes .

• Cascade of cellular dysfunction: The depletion of iron-sulfur cluster proteins leads to:

  • Profound impairment of mitochondrial respiration

  • Global depletion of iron-sulfur cluster proteins

  • Accumulation of DNA damage (evidenced by increased γH2AX foci)

  • Ultimately culminating in cell death

This represents a classic example of paralog synthetic lethality, where "Given that paralogs oftentimes perform redundant cellular functions, one paralog can become indispensable if the function of the corresponding paralog is compromised" . Targeting MFRN2 in MFRN1-deficient tumors has demonstrated preclinical efficacy, including impaired growth and tumor eradication in mouse xenograft experiments .

How can mitochondrial iron uptake through Mitoferrin-2 be quantitatively measured in experimental settings?

Measuring mitochondrial iron uptake through Mitoferrin-2 requires specialized techniques that can distinguish between cytosolic and mitochondrial iron pools. Based on published methodologies:

• Calcein-based fluorescence quenching assay:

  • Cells are permeabilized with digitonin (10 μM) in an intracellular buffer

  • Calcein-free acid (5 μM) is added to the extracellular space

  • Fluorescence (495-nm excitation/515-nm emission) is measured at 37°C

  • Iron uptake rates can be calculated by measuring the quenching of calcein fluorescence as iron enters mitochondria

• Buffer composition for mitochondrial iron uptake measurement:

  • 125 mM KCl

  • 2 mM K2HPO4

  • 2.5 mM KH2PO4

  • 20 mM HEPES buffer, pH 7.4

  • 0.02 mM EGTA

  • 5 mM Na2 succinate

  • 2 mM ATP

  • 3 mM glutathione

  • 1 μM rotenone

  • 2 μM thapsigargin

  • 5 μM oligomycin

  • 1 μg/ml protease inhibitors (pepstatin, antipain, and leupeptin)

• Experimental controls:

  • Iron chelators (to establish baseline)

  • Ru360 (inhibitor of the mitochondrial Ca2+ and Fe2+ uniporter)

  • Cells with Mitoferrin-2 knockdown (demonstrate specificity)

Comparative analysis of mitochondrial iron uptake rates between high and low Mitoferrin-2-expressing cells has shown that cells with higher MFRN2 expression demonstrate higher rates of mitochondrial Fe2+ uptake .

What cellular phenotypes emerge following Mitoferrin-2 depletion in different experimental contexts?

The phenotypic consequences of Mitoferrin-2 depletion vary significantly depending on the cellular context, particularly the status of its paralog Mitoferrin-1:

• In MFRN1-proficient cells:

  • Minimal impact on cell viability

  • Limited effect on mitochondrial function

  • Cells continue to proliferate normally

• In MFRN1-deficient cells (e.g., cells with chromosome 8p deletion):

  • Profound impairment of mitochondrial respiration

  • Global depletion of iron-sulfur cluster proteins

  • DNA damage accumulation (measured by γH2AX foci formation)

  • Cell cycle analysis reveals significant alterations in cell cycle distribution

  • Senescence induction (detectable by SA-β-galactosidase assay)

  • Ultimately progressing to cell death

• In photodynamic therapy (PDT) contexts:

  • MFRN2 depletion delays PDT-induced mitochondrial depolarization

  • Protects against PDT plus bafilomycin-induced cytotoxicity

  • Decreases the rate of mitochondrial Fe2+ uptake

These observations can be quantified using various experimental approaches:

• Colony formation assays to assess long-term survival

• Flow cytometry-based competition assays

• Cell cycle analysis using DAPI staining and flow cytometry

• Senescence detection via SA-β-galactosidase assay

• Mitochondrial function assessment via respiration measurement

How does Mitoferrin-2 expression correlate with sensitivity to photodynamic therapy in cancer cells?

Research has established a significant correlation between Mitoferrin-2 expression and photodynamic therapy (PDT) sensitivity, particularly in head and neck squamous carcinoma cell lines:

• Expression-sensitivity relationship:

  • PDT-sensitive cells (e.g., UMSCC22A) express higher MFRN2 mRNA and protein levels

  • PDT-resistant cells (e.g., UMSCC1, UMSCC14A) show lower MFRN2 expression

  • High MFRN2-expressing cells demonstrate higher rates of mitochondrial Fe2+ uptake

• Mechanistic basis:

  • Lysosomal iron release (induced by bafilomycin, an inhibitor of the vacuolar proton pump)

  • MFRN2-dependent mitochondrial iron uptake

  • These processes act synergistically to induce PDT-mediated and iron-dependent mitochondrial dysfunction

• Experimental evidence:

  • Knockdown of MFRN2 in high-expressing cells (UMSCC22A) decreases mitochondrial Fe2+ uptake

  • MFRN2 depletion delays PDT plus bafilomycin-induced mitochondrial depolarization

  • MFRN2 knockdown protects against PDT-induced cell killing

  • Iron chelators and Ru360 (inhibitor of mitochondrial Fe2+ uniporter) provide protection against PDT toxicity

These findings suggest that MFRN2 expression levels could potentially serve as a biomarker to predict PDT response in head and neck cancers, with higher expression correlating with increased therapeutic efficacy .

What methodological approaches can be used to study iron-sulfur cluster protein depletion following Mitoferrin disruption?

Iron-sulfur cluster protein depletion is a critical consequence of combined Mitoferrin-1 and Mitoferrin-2 disruption. The following methodological approaches can be employed to study this phenomenon:

• Aconitase activity assay:

  • Cells are harvested, washed with ice-cold PBS, and resuspended in aconitase preservation solution

  • After lysis and centrifugation, protein concentration is determined

  • Equal amounts of protein are transferred to assay plates

  • Assay buffer is added and activity is measured using a kinetic program on a plate reader (e.g., SPECTROStar Nano microplate reader)

• Immunoblotting for iron-sulfur cluster proteins:

  • Standard immunoblotting protocols with antibodies against specific iron-sulfur cluster proteins

  • Appropriate loading controls (e.g., VINCULIN) should be included

  • Quantification can be performed using densitometry

• Assessment of downstream consequences:

  • DNA damage: Immunoblotting or immunofluorescence for γH2AX

  • Mitochondrial respiration: Oxygen consumption measurements

  • Cell death: Flow cytometry-based assays

For immunofluorescence detection of γH2AX:

• Cells are fixed and permeabilized

• Primary antibody against γH2AX (mouse, Merck Millipore, 05-636, 1:200 dilution)

• Secondary antibody conjugated with Alexa Fluor 594 (1:450 dilution)

• Hoechst staining for nuclei (1:20,000 dilution)

• Analysis using fluorescence microscopy (e.g., AXIO Observer.Z1)

What experimental models are most appropriate for studying Mitoferrin-2 function in different research contexts?

The selection of experimental models for Mitoferrin-2 research depends on the specific research question and context:

• Cancer research models:

  • Human cancer cell lines with chromosome 8p deletion (to study synthetic lethality)

  • Isogenic cell line pairs with and without MFRN1 knockout

  • Xenograft mouse models for in vivo validation of therapeutic strategies

• Photodynamic therapy research:

  • Head and neck squamous carcinoma cell lines with varying MFRN2 expression levels

  • Cell lines can be stratified based on their PDT sensitivity (e.g., UMSCC1 and UMSCC14A as resistant models, UMSCC22A as sensitive model)

• Model system specifications:

  • Cell culture conditions: DMEM containing 4500 mg/L glucose, L-glutamine, sodium pyruvate, and sodium bicarbonate, supplemented with 10% FCS and 1% penicillin/streptomycin

  • For inducible systems: Medium supplemented with 1 μg/mL doxycycline, changed every 48 hours

  • Incubation at 37°C with 5% CO2

• Genetic manipulation approaches:

  • shRNA-mediated knockdown (inducible or constitutive)

  • CRISPR/Cas9-mediated knockout

  • Complementary experimental designs combining both approaches for validation

When designing these experiments, it is crucial to include appropriate controls and to validate model systems by confirming Mitoferrin-1 and Mitoferrin-2 expression levels using qRT-PCR and immunoblotting.

How should researchers interpret contradictory results when studying Mitoferrin-2 in different cell types?

When faced with contradictory results in Mitoferrin-2 research across different cell types, systematic analysis should include:

• Paralog expression assessment:

  • Quantify both MFRN1 and MFRN2 expression levels in each cell type

  • Consider chromosome 8p status and its impact on MFRN1 expression

  • The relative expression ratio between MFRN1 and MFRN2 may be more informative than absolute levels of either protein alone

• Cell type-specific factors:

  • Baseline iron metabolism and requirements vary between cell types

  • Mitochondrial content and dependence on oxidative phosphorylation differ

  • Cancer versus non-cancer cells may have fundamentally different metabolic adaptations

• Experimental approach considerations:

  • Acute versus chronic MFRN2 depletion may yield different phenotypes

  • Complete knockout versus partial knockdown can produce distinct outcomes

  • The timing of analyses after MFRN2 depletion is critical (phenotypes may take several days to manifest)

• Methodological troubleshooting:

  • Verify knockdown/knockout efficiency at both mRNA and protein levels

  • Confirm specificity of observed effects through rescue experiments

  • Consider compensatory mechanisms that may emerge after prolonged MFRN2 deficiency

A systematic approach to resolving contradictions includes side-by-side comparison of different cell types under identical experimental conditions, comprehensive characterization of iron metabolism parameters, and validation using complementary methodological approaches.

What are the key considerations for designing in vivo experiments to validate Mitoferrin-2 as a therapeutic target?

Designing robust in vivo experiments to validate Mitoferrin-2 as a therapeutic target requires careful consideration of multiple factors:

• Model selection:

  • Xenograft models using cell lines with confirmed chromosome 8p deletion and MFRN1 deficiency

  • Patient-derived xenografts to better recapitulate tumor heterogeneity

  • Genetic mouse models with conditional MFRN1/MFRN2 manipulation

• Intervention strategies:

  • Genetic approaches: inducible shRNA or CRISPR systems targeting MFRN2

  • Timing considerations: intervention initiation at different tumor stages

  • Delivery methods: ensuring efficient targeting of MFRN2 in tumor cells

• Outcome measurements:

  • Tumor growth kinetics via caliper measurements or imaging

  • Survival analysis

  • Ex vivo analyses of harvested tumors:

    • Confirmation of MFRN2 knockdown/knockout

    • Assessment of iron-sulfur cluster protein levels

    • Evaluation of DNA damage markers (γH2AX)

    • Analysis of cell death mechanisms

• Controls and validation:

  • Non-targeting shRNA or sgRNA controls

  • MFRN1-proficient models as negative controls

  • Rescue experiments to confirm specificity

  • Pharmacological approaches to complement genetic targeting

• Potential challenges:

  • Compensatory mechanisms in prolonged studies

  • Tumor microenvironment influences

  • Systemic effects of MFRN2 depletion on normal tissues

  • Variability in MFRN1 expression within heterogeneous tumors

The preclinical evidence supporting MFRN2 as a therapeutic target is promising, with studies demonstrating that "MFRN2 depletion in MFRN1-deficient tumors led to impaired growth and even tumor eradication in preclinical mouse xenograft experiments" .

What is the recommended protocol for assessing cell cycle alterations following Mitoferrin-2 depletion?

The following protocol is recommended for assessing cell cycle alterations following Mitoferrin-2 depletion:

• Sample preparation:

  • Harvest cells by collecting culture medium together with trypsinized cells

  • Wash using 1× PBS and transfer into 1.5-ml reaction tubes

  • Resuspend cells in 100 μl ice-cold PBS

  • Add 900 μl ice-cold 80% EtOH in a dropwise fashion while vortexing for fixation

  • Store at −20°C for at least 24 hours

• Cell cycle analysis:

  • Centrifuge fixed cells and rehydrate in 1 ml PBS for 15 minutes

  • Adjust cell number to 5 × 105 cells

  • Add DAPI as a DNA-intercalating agent

  • Measure cellular DNA content near 500 nm emission using flow cytometry

• Data analysis:

  • Quantify the percentage of cells in G0/G1, S, and G2/M phases

  • Identify sub-G1 population (indicative of apoptotic cells)

  • Compare cell cycle distribution between control and MFRN2-depleted conditions

  • Analyze time-course data to determine progressive changes

• Experimental design considerations:

  • Include appropriate time points (cell cycle alterations may take several days to manifest)

  • Use both MFRN1-proficient and MFRN1-deficient cellular contexts

  • Include positive controls for cell cycle arrest (e.g., treatments with known cell cycle inhibitors)

This protocol enables quantitative assessment of how MFRN2 depletion affects cell cycle progression, which is particularly pronounced in MFRN1-deficient contexts.

How can senescence induction be accurately measured following combined Mitoferrin-1/2 deficiency?

Senescence induction following combined Mitoferrin-1/2 deficiency can be accurately measured using the following SA-β-galactosidase assay protocol:

• Sample preparation:

  • Seed cells in appropriate density in complete DMEM in triplicates in 6-well plates

  • Allow cells to grow for at least 10 days after MFRN2 depletion in MFRN1-deficient background

  • Wash cells twice in 1× PBS to remove all residual medium

• Fixation:

  • Add fixation solution containing 2% (v/v) formaldehyde and 0.2% (v/v) glutaraldehyde

  • Incubate for no longer than 5 minutes to avoid destruction of β-galactosidase activity

  • Wash fixed cells twice with 1× PBS and once in dH2O

• Staining procedure:

  • Incubate cells in staining solution at pH 6.0 for 12-16 hours without CO2 at 37°C

  • Aspirate staining solution and wash cells twice in 1× PBS followed by a one-time wash in MeOH

  • Allow stained and fixed cells to air dry

• Analysis:

  • Examine cells using bright-field microscopy (e.g., AXIO Observer.Z1 Fluorescence Phase Contrast Microscope)

  • Quantify the percentage of senescent cells (appearing blue due to β-galactosidase activity)

  • Compare between experimental conditions

• Complementary assays:

  • Expression analysis of senescence markers (p16, p21) by qRT-PCR or immunoblotting

  • Assessment of senescence-associated secretory phenotype (SASP) markers

  • Evaluation of persistent DNA damage foci (γH2AX) by immunofluorescence

This integrated approach provides a comprehensive assessment of senescence induction, which is a key cellular response to combined MFRN1/2 deficiency in certain cellular contexts.

What are the best practices for designing competition assays to evaluate Mitoferrin-2 dependency in cancer cells?

Competition assays provide a powerful approach to evaluate Mitoferrin-2 dependency in cancer cells. The following best practices should be implemented:

• Experimental design:

  • Mix cells with differential MFRN2 status in a defined ratio (e.g., 30:70)

  • Include a fluorescent marker (e.g., GFP) in one population to enable tracking

  • Monitor the relative abundance of each population over time

• Specific methodologies:

  • For CRISPR-based competition assays:

    • Mix human and murine SpCas9 competent cell lines expressing either non-targeting sgRNA (sgCTR) or sgRNA targeting MFRN1 with lentiviral constructs expressing either non-targeting sgRNA or sgRNA targeting MFRN2 together with GFP

  • For knockdown-dependent competition assays:

    • Mix Cas9-dependent single-KO cells of MFRN1 or sgCTR cells with cells expressing either shRNA targeting Renilla luciferase (shRen) or MFRN2 together with GFP in a doxycycline-dependent manner

• Technical specifications:

  • Initial cell seeding: 2 × 105 cells in 6-well plates

  • Technical replicates: minimum of 3

  • Biological replicates: minimum of 3

  • For inducible systems: pre-treat with doxycycline (1 μg/mL) 36 hours prior to assay start

  • Change doxycycline-containing medium every 2 days

• Data acquisition and analysis:

  • Use flow cytometry (e.g., guava easyCyte HT system) to measure GFP-positive percentage

  • Track changes over time (multiple time points spanning 1-2 weeks)

  • Calculate relative fitness using the formula: log2(percentage of GFP+ cells at time point / percentage of GFP+ cells at baseline)

  • Statistical analysis comparing different experimental conditions

• Controls and validation:

  • Non-targeting sgRNA or shRNA controls

  • MFRN1-proficient controls to demonstrate specificity

  • Independent validation using orthogonal approaches (e.g., colony formation assays)

This methodological approach enables robust assessment of MFRN2 dependency in various genetic backgrounds, particularly in identifying synthetic lethal interactions with MFRN1 deficiency.

How should researchers design experiments to investigate the role of Mitoferrin-2 in iron-dependent DNA damage?

Investigating the role of Mitoferrin-2 in iron-dependent DNA damage requires a multi-faceted experimental approach:

• γH2AX detection:

  • Immunoblotting protocol:

    • Standard protein extraction and SDS-PAGE

    • Primary antibody: anti-γH2AX (Mouse, Merck Millipore, 05-636, 1:200 dilution)

    • Secondary antibody: HRP-conjugated goat anti-mouse (1:5000)

    • Include loading controls (e.g., VINCULIN)

  • Immunofluorescence protocol:

    • Seed cells on coverslips

    • Fix and permeabilize cells

    • Block with appropriate blocking solution

    • Primary antibody: anti-γH2AX (Mouse, Merck Millipore, 05-636, 1:200)

    • Secondary antibody: Alexa Fluor 594-conjugated anti-mouse (1:450)

    • Nuclear counterstain: Hoechst (1:20,000)

    • Mount slides with Mowiol and analyze using fluorescence microscopy

• Experimental design considerations:

  • Generate cellular models with varied MFRN1/MFRN2 status:

    • Wild-type controls

    • MFRN1 knockout/knockdown

    • MFRN2 knockout/knockdown

    • Combined MFRN1/MFRN2 depletion

  • Time course experiments:

    • Monitor DNA damage accumulation over time after MFRN2 depletion

    • Include early time points (6-24 hours) and later time points (several days)

  • Iron manipulation experiments:

    • Iron chelators to determine if DNA damage is iron-dependent

    • Iron supplementation to assess rescue effects

• Quantification approaches:

  • For immunofluorescence: Count γH2AX foci per nucleus across multiple fields

  • For immunoblotting: Densitometric analysis normalized to loading controls

  • Statistical analysis comparing different experimental conditions

• Mechanistic investigations:

  • Assess mitochondrial function (respiration, membrane potential)

  • Measure reactive oxygen species (ROS) production

  • Evaluate iron-sulfur cluster protein levels and activity

  • Investigate DNA repair pathway activation/impairment

This comprehensive approach enables detailed characterization of the relationship between MFRN2, iron metabolism, and DNA damage induction, particularly in contexts of MFRN1 deficiency.

What are the emerging therapeutic strategies targeting Mitoferrin-2 in cancer and what methodological challenges remain?

Based on current research findings, several promising therapeutic strategies targeting Mitoferrin-2 are emerging, alongside significant methodological challenges:

• Therapeutic approaches:

  • Direct MFRN2 inhibition in MFRN1-deficient cancers (chromosome 8p deleted tumors)

  • Combination approaches with iron chelators or iron-dependent pathway inhibitors

  • Synthetic lethal interactions with DNA damage response pathways

  • Enhanced photodynamic therapy in MFRN2-high expressing tumors

• Biomarker development:

  • MFRN1 expression as a biomarker for MFRN2-targeted therapies

  • Chromosome 8p status as a predictive indicator

  • Development of clinically applicable assays to measure MFRN1/2 levels

• Methodological challenges:

  • Development of specific MFRN2 inhibitors (currently limited to genetic approaches)

  • Optimization of delivery methods for MFRN2-targeting therapeutics

  • Establishment of preclinical models that accurately recapitulate human disease

  • Identification of resistance mechanisms to MFRN2-targeting strategies

• Potential combination strategies:

  • MFRN2 inhibition plus DNA damage response inhibitors

  • MFRN2 targeting plus iron chelation therapy

  • MFRN2 inhibition combined with conventional chemotherapy or radiation

• Required methodological advances:

  • Development of high-throughput screening assays for MFRN2 inhibitors

  • Improved methods for real-time monitoring of mitochondrial iron levels

  • Advanced imaging techniques to assess MFRN2 function in vivo

  • Clinical trial designs specific for MFRN1-deficient cancer populations

Research suggests that "MFRN2 depletion in MFRN1-deficient tumors led to impaired growth and even tumor eradication in preclinical mouse xenograft experiments, highlighting its therapeutic potential" . This promising preclinical evidence supports further development of MFRN2-targeting therapeutic strategies.

How might integrative multi-omics approaches advance our understanding of Mitoferrin-2 biology in health and disease?

Integrative multi-omics approaches offer powerful methodologies to advance Mitoferrin-2 biology research:

• Genomic approaches:

  • Analysis of cancer genomics databases (TCGA, CCLE, DepMap) to identify correlations between chromosome 8p status, MFRN1 expression, and cancer vulnerabilities

  • Genome-wide CRISPR screens to identify synthetic lethal interactions with MFRN2

  • SNP association studies to identify genetic variants affecting MFRN1/2 function

• Transcriptomic analyses:

  • RNA-seq to profile global transcriptional changes following MFRN2 depletion

  • Single-cell transcriptomics to assess heterogeneity in MFRN1/2 expression within tumors

  • Analysis of gene expression networks co-regulated with MFRN1/2

• Proteomic investigations:

  • Global proteomics to identify changes in protein expression following MFRN1/2 depletion

  • Focused analysis of iron-sulfur cluster proteins

  • Post-translational modification analysis to understand regulation of MFRN1/2 function

• Metabolomic profiling:

  • Assessment of metabolic alterations in response to MFRN1/2 deficiency

  • Analysis of iron metabolism and related pathways

  • Mitochondrial metabolite profiling

• Integrative data analysis strategies:

  • Machine learning approaches to identify patterns across multi-omics datasets

  • Network biology to understand the broader context of MFRN1/2 function

  • Systems biology modeling of iron metabolism and mitochondrial function

• Clinical implications:

  • Development of multi-omics signatures for patient stratification

  • Identification of novel therapeutic targets within MFRN1/2-associated pathways

  • Personalized medicine approaches based on integrated biomarker profiles

The application of these integrative approaches could significantly advance our understanding of MFRN2 biology and accelerate the development of targeted therapeutic strategies, particularly for chromosome 8p-deleted cancers where "MFRN2 has been identified as a specific vulnerability" .