When searching databases or literature for OR2H1, researchers should be aware of its multiple nomenclature variants:
| Database Identifier | Value |
|---|---|
| UniProt ID | Q9GZK4 |
| Gene Name | OR2H1 |
| Synonyms | OR2H1; OR2H6; OR2H8; Olfactory receptor 2H1; Hs6M1-16; OLFR42A-9004.14/9026.2; Olfactory receptor 2H6; Olfactory receptor 2H8; Olfactory receptor 6-2; OR6-2; Olfactory receptor OR6-32 |
Using these alternative identifiers is crucial when conducting comprehensive literature searches or when cross-referencing between different database resources .
Recombinant OR2H1 protein requires specific storage and handling conditions to maintain stability and functionality:
Storage temperature: Store at -20°C/-80°C upon receipt
Preparation: Briefly centrifuge vials before opening to bring contents to the bottom
Reconstitution: Use deionized sterile water to a concentration of 0.1-1.0 mg/mL
Long-term storage: Add 5-50% glycerol (recommended final concentration: 50%) and aliquot before freezing
Working storage: Store working aliquots at 4°C for up to one week
Avoid: Repeated freeze-thaw cycles
The protein is typically supplied as a lyophilized powder in a Tris/PBS-based buffer with 6% Trehalose at pH 8.0. Proper aliquoting is essential for maintaining protein integrity across multiple experiments .
For structural studies using E. coli:
Clone the OR2H1 coding sequence into a bacterial expression vector with an N-terminal His-tag
Transform into an appropriate E. coli strain (BL21 derivatives commonly used)
Induce expression using IPTG at reduced temperatures (16-20°C) to enhance proper folding
Purify using immobilized metal affinity chromatography (IMAC)
For functional studies in mammalian cells:
The TAR-Tat system significantly improves transcriptional efficiency and functional expression
This system utilizes positive feedback mechanisms to enhance protein production
Transfect mammalian cells (HEK293T commonly used) with vectors containing the OR2H1 gene under control of the TAR promoter
Co-express with the HIV Tat protein to drive transcriptional enhancement
The TAR-Tat system has demonstrated particular effectiveness for olfactory receptors that traditionally show poor heterologous expression, resulting in significantly improved cell surface localization and functional response to odorants .
Poor membrane expression represents a major challenge when working with olfactory receptors including OR2H1. Several methodological approaches have proven effective:
Transcriptional enhancement using the TAR-Tat system:
Increases OR2H1 transcription through positive feedback mechanisms
Results in significantly improved cell surface expression
Enhances functional response to potential ligands
Co-expression with accessory proteins:
Receptor transporting proteins (RTPs)
Receptor expression enhancing proteins (REEPs)
Olfactory-specific G proteins
Optimization of expression vector elements:
Use of strong, tissue-specific promoters
Incorporation of optimized Kozak sequences
Addition of appropriate signal peptides
Cell line selection:
HEK293T cells provide good expression for functional studies
Sf9 insect cells may be used for structural studies requiring higher protein yields
Cultivation conditions:
Growth at reduced temperatures (30-32°C for mammalian cells)
Addition of chemical chaperones to culture media (e.g., DMSO, glycerol)
Controlled induction protocols for inducible expression systems
Researchers have reported that combining the TAR-Tat system with accessory proteins can result in up to 15-fold increases in functional cell surface expression compared to conventional approaches .
Multiple complementary approaches should be used to quantify OR2H1 expression:
RNA-level quantification:
Real-time quantitative PCR (RT-qPCR) using validated primers
Forward primer: 5'-TCACTCAGTACAGCTCCCATGC-3'
Reverse primer: 5'-TTCAGTTCTTGCAATTAAGTCAGACTCT-3'
Normalize to endogenous reference genes (e.g., GAPDH)
RNA-Seq for comprehensive transcriptomic analysis
Protein-level quantification:
Western blot analysis using validated antibodies
Flow cytometry for cell surface expression analysis
Immunohistochemistry/immunofluorescence for tissue localization
ELISA for quantitative protein measurements
Functional expression assessment:
Calcium mobilization assays upon ligand stimulation
cAMP accumulation assays to measure receptor activation
Electrophysiological recordings in expression systems
When performing immunodetection, recombinant OR2H1 IgG can be conjugated to fluorophores like phycoerythrin (PE) for enhanced sensitivity. For tissue samples, optimization of antigen retrieval protocols is essential to overcome potential epitope masking in fixed tissues .
While comprehensive ligand screening for OR2H1 remains ongoing, several approaches are used to identify and characterize ligand interactions:
Calcium flux assays:
Transfect cells with OR2H1 and a calcium-sensitive reporter (e.g., GCaMP)
Expose to potential ligands and measure fluorescence changes
Analysis of dose-response relationships
cAMP accumulation assays:
Measure changes in intracellular cAMP levels upon receptor activation
Use of EPAC-based FRET sensors for real-time monitoring
Luciferase reporter assays:
Coupling OR2H1 activation to reporter gene expression
Quantitative readout of receptor function
Surface plasmon resonance (SPR):
Direct measurement of binding between purified OR2H1 and potential ligands
Determination of binding kinetics and affinity constants
Recent studies have identified n-hexanal as a potential ligand for some olfactory receptors, though specific binding to OR2H1 requires further validation. Interestingly, n-hexanal has been identified as an inverse agonist for certain olfactory receptors, suggesting complex regulatory mechanisms within the olfactory receptor family .
CRISPR/Cas9-mediated gene editing provides powerful approaches for investigating OR2H1 function:
For OR2H1 ablation:
Design specific crRNA targeting OR2H1 (e.g., GACAGCCACGTATCGGTCAA)
Reconstitute crRNA in nuclease-free buffer and anneal with tracrRNA
Mix with Cas9 protein to form ribonucleoproteins (RNPs)
Deliver to target cells via electroporation (optimal conditions: 1,230 V, 30 ms, 2 pulses)
Confirm knockout via Western blot or functional assays
For mechanistic studies:
Generate cell lines with OR2H1 knockout
Compare phenotypic changes (proliferation, metabolism, etc.)
Perform rescue experiments by reintroducing wild-type or mutant OR2H1
For structure-function analysis:
Create precise point mutations in key domains
Evaluate effects on receptor trafficking, ligand binding, and signaling
CRISPR/Cas9-mediated ablation of OR2H1 has revealed its role in glucose metabolism in certain cancer cell lines, demonstrating the utility of this approach for uncovering non-canonical functions of olfactory receptors .
OR2H1 presents a promising target for CAR T cell therapy against solid tumors due to its differential expression pattern. The methodology for developing OR2H1-targeted CAR T cells includes:
CAR construct design:
Identify antibody fragments recognizing the extracellular domain of OR2H1 using phage display library screening
Design CAR construct with:
Olfactory receptor signal peptide
OR2H1 single-chain variable fragment (scFv)
Glycine/serine spacer
CD8α hinge and transmembrane domains
Intracellular signaling domains (4-1BB and CD3ζ)
Expression validation:
Clone construct into retroviral vectors
Transduce T cells and confirm expression via flow cytometry
Validate specificity using OR2H1-expressing and non-expressing cell lines
Functional assessment:
Cytotoxicity assays against OR2H1-positive tumor cells
Measurement of cytokine production (IFNγ, IL-2)
In vivo tumor models to evaluate efficacy and safety
Studies have demonstrated that OR2H1-targeted CAR T cells exhibit specific cytotoxicity against OR2H1-expressing tumor cells both in vitro and in vivo, suggesting potential clinical applications. The limited expression pattern of OR2H1 in normal tissues (primarily testis) suggests a favorable safety profile for clinical translation .
Recent findings suggest OR2H1 may influence cancer cell metabolism, particularly glucose utilization. Methodological approaches to investigate this include:
Glucose uptake assessment:
Use fluorescent glucose analogs (e.g., 2-NBDG) to measure uptake in cells with or without OR2H1 expression
Compare wild-type cells with OR2H1-knockout cells generated via CRISPR/Cas9
Metabolic profiling:
Perform extracellular flux analysis (Seahorse) to measure glycolytic rate and oxidative phosphorylation
Conduct stable isotope labeling experiments to track glucose fate in cellular metabolism
Mechanistic studies:
Investigate downstream signaling pathways using phosphoproteomic analysis
Examine regulation of key metabolic enzymes and transporters
Explore potential interactions with established metabolic regulators
Therapeutic implications:
Evaluate synergistic effects between OR2H1 targeting and metabolic inhibitors
Assess tumor growth in vivo following OR2H1 ablation or inhibition
CRISPR/Cas9-mediated ablation of OR2H1 has demonstrated impaired tumor growth in preclinical models, supporting the therapeutic potential of targeting this receptor. Understanding the metabolic functions of OR2H1 may reveal novel vulnerabilities in OR2H1-expressing tumors that could be exploited therapeutically .
Comprehensive expression profiling of OR2H1 requires multi-platform validation:
Transcriptomic analysis:
RT-qPCR analysis across normal tissues and tumor samples
RNA-Seq data from cancer genomics databases (TCGA, ICGC)
Single-cell RNA-Seq for cellular heterogeneity assessment
Protein-level validation:
Western blot analysis with validated antibodies
Immunohistochemistry on tissue microarrays
Flow cytometry for cell line characterization
Tissue distribution findings:
Limited expression in normal tissues, primarily restricted to testis
Widespread expression in solid epithelial tumors including:
Ovarian cancers (various histologies)
Non-small cell lung cancers
Breast cancers
Cholangiocarcinomas
Quantitative assessment:
Recombinant OR2H1 IgG specifically detects OR2H1 protein in cancer tissues
Positivity rates of 60 human lung cancers, 40 ovarian carcinomas, and 73 cholangiocarcinomas comparable to mRNA expression levels
Absence of OR2H1 staining in 58 normal tissues examined
This tumor-restricted expression pattern makes OR2H1 particularly valuable as a therapeutic target with potentially minimal off-target effects. The complementary use of RNA and protein detection methods is essential for reliable expression profiling .
Researchers frequently encounter several challenges when working with OR2H1:
Poor expression and inclusion body formation:
Solution: Optimize expression conditions (temperature, induction time)
Use solubility-enhancing fusion tags (MBP, SUMO)
Explore refolding protocols for inclusion body recovery
Inefficient membrane trafficking:
Solution: Utilize the TAR-Tat system for transcriptional enhancement
Co-express with trafficking enhancers (RTPs, REEPs)
Optimize signal peptide sequences
Protein instability:
Solution: Include stabilizing agents in buffers (glycerol, trehalose)
Store in aliquots to avoid freeze-thaw cycles
Maintain strict temperature control during purification
Non-specific antibody binding:
Solution: Validate antibodies using knockout controls
Optimize blocking conditions to reduce background
Consider epitope-tagged versions for detection
Variability in functional assays:
Solution: Standardize cell density and passage number
Include positive and negative controls in each experiment
Validate assay conditions with known olfactory receptor ligands
Detailed troubleshooting guides have been developed by experienced research groups, emphasizing the importance of systematic optimization approaches when working with challenging membrane proteins like OR2H1 .
The TAR-Tat system provides a powerful approach for enhancing OR2H1 expression:
System components:
TAR (Trans-Activation Response) element: Placed upstream of the OR2H1 gene
Tat (Trans-Activator of Transcription): HIV-derived transcriptional activator
Implementation protocol:
Clone the OR2H1 gene downstream of the TAR element
Co-express the Tat protein in the same cells
The Tat protein binds to the TAR element, enhancing transcription
Positive feedback develops as more Tat protein is produced
Optimization considerations:
Balance Tat expression levels to avoid cellular toxicity
Optimize the ratio of TAR-OR2H1 to Tat expression vectors
Consider inducible Tat expression for temporal control
Verification of enhancement:
Measure OR2H1 mRNA levels via RT-qPCR
Assess cell surface expression via flow cytometry
Evaluate functional responses to potential ligands
The TAR-Tat system has demonstrated substantial improvements in both cell surface expression and functional responses of olfactory receptors, making previously undetectable responses measurable. This approach is particularly valuable for characterizing the relationship between olfactory receptors and their cognate odorants .
OR2H1 research is opening new avenues in precision medicine, particularly in oncology:
Diagnostic applications:
Development of OR2H1-based biomarkers for early cancer detection
Integration into multi-marker panels for improved sensitivity and specificity
Liquid biopsy approaches targeting OR2H1 expression
Therapeutic strategies:
OR2H1-targeted CAR T cell therapy for solid tumors
Development of OR2H1-specific antibody-drug conjugates
Small molecule modulators of OR2H1 signaling
Patient stratification:
Identification of patient subgroups with OR2H1-high tumors
Correlation with treatment response and clinical outcomes
Integration with multi-omics data for comprehensive profiling
Resistance mechanisms:
Investigation of OR2H1 regulation in treatment-resistant tumors
Exploration of combination therapies targeting OR2H1 and complementary pathways
Development of strategies to overcome resistance to OR2H1-targeted therapies
The tumor-specific expression pattern of OR2H1 makes it particularly promising for precision oncology applications with potentially limited off-target effects. Ongoing research is focused on translating these findings into clinical applications .
Computational methods provide valuable insights into OR2H1 biology:
Structural modeling:
Homology modeling based on resolved GPCR structures
Molecular dynamics simulations to explore conformational dynamics
Virtual screening for potential ligands and interaction partners
Machine learning applications:
Prediction of ligand-binding properties
Classification of tumor samples based on OR2H1 expression patterns
Integration of multi-omics data to identify regulatory networks
Systems biology approaches:
Network analysis to identify OR2H1 signaling pathways
Genome-wide association studies linking OR2H1 variants to phenotypes
Multi-scale modeling of OR2H1 function in cellular contexts
Evolutionary analysis:
Comparative genomics across species to identify conserved domains
Analysis of selection pressures on OR2H1 sequences
Identification of functionally important residues
These computational approaches complement experimental methods and provide testable hypotheses for further investigation. The integration of computational and experimental approaches is particularly valuable for understanding complex signaling systems like olfactory receptors .