Recombinant Human Olfactory receptor 2H1 (OR2H1)

What are the known synonyms and database identifiers for OR2H1?

When searching databases or literature for OR2H1, researchers should be aware of its multiple nomenclature variants:

Using these alternative identifiers is crucial when conducting comprehensive literature searches or when cross-referencing between different database resources .

What are the optimal storage and handling conditions for recombinant OR2H1 protein?

Recombinant OR2H1 protein requires specific storage and handling conditions to maintain stability and functionality:

• Storage temperature: Store at -20°C/-80°C upon receipt

• Preparation: Briefly centrifuge vials before opening to bring contents to the bottom

• Reconstitution: Use deionized sterile water to a concentration of 0.1-1.0 mg/mL

• Long-term storage: Add 5-50% glycerol (recommended final concentration: 50%) and aliquot before freezing

• Working storage: Store working aliquots at 4°C for up to one week

• Avoid: Repeated freeze-thaw cycles

The protein is typically supplied as a lyophilized powder in a Tris/PBS-based buffer with 6% Trehalose at pH 8.0. Proper aliquoting is essential for maintaining protein integrity across multiple experiments .

What expression systems are most effective for producing functional recombinant OR2H1?

For structural studies using E. coli:

• Clone the OR2H1 coding sequence into a bacterial expression vector with an N-terminal His-tag

• Transform into an appropriate E. coli strain (BL21 derivatives commonly used)

• Induce expression using IPTG at reduced temperatures (16-20°C) to enhance proper folding

• Purify using immobilized metal affinity chromatography (IMAC)

For functional studies in mammalian cells:

• The TAR-Tat system significantly improves transcriptional efficiency and functional expression

• This system utilizes positive feedback mechanisms to enhance protein production

• Transfect mammalian cells (HEK293T commonly used) with vectors containing the OR2H1 gene under control of the TAR promoter

• Co-express with the HIV Tat protein to drive transcriptional enhancement

The TAR-Tat system has demonstrated particular effectiveness for olfactory receptors that traditionally show poor heterologous expression, resulting in significantly improved cell surface localization and functional response to odorants .

How can researchers overcome the challenge of poor membrane expression of OR2H1?

Poor membrane expression represents a major challenge when working with olfactory receptors including OR2H1. Several methodological approaches have proven effective:

• Transcriptional enhancement using the TAR-Tat system:

  • Increases OR2H1 transcription through positive feedback mechanisms

  • Results in significantly improved cell surface expression

  • Enhances functional response to potential ligands

• Co-expression with accessory proteins:

  • Receptor transporting proteins (RTPs)

  • Receptor expression enhancing proteins (REEPs)

  • Olfactory-specific G proteins

• Optimization of expression vector elements:

  • Use of strong, tissue-specific promoters

  • Incorporation of optimized Kozak sequences

  • Addition of appropriate signal peptides

• Cell line selection:

  • HEK293T cells provide good expression for functional studies

  • Sf9 insect cells may be used for structural studies requiring higher protein yields

• Cultivation conditions:

  • Growth at reduced temperatures (30-32°C for mammalian cells)

  • Addition of chemical chaperones to culture media (e.g., DMSO, glycerol)

  • Controlled induction protocols for inducible expression systems

Researchers have reported that combining the TAR-Tat system with accessory proteins can result in up to 15-fold increases in functional cell surface expression compared to conventional approaches .

What methods are most effective for quantifying OR2H1 expression in experimental samples?

Multiple complementary approaches should be used to quantify OR2H1 expression:

• RNA-level quantification:

  • Real-time quantitative PCR (RT-qPCR) using validated primers

    • Forward primer: 5'-TCACTCAGTACAGCTCCCATGC-3'

    • Reverse primer: 5'-TTCAGTTCTTGCAATTAAGTCAGACTCT-3'

  • Normalize to endogenous reference genes (e.g., GAPDH)

  • RNA-Seq for comprehensive transcriptomic analysis

• Protein-level quantification:

  • Western blot analysis using validated antibodies

  • Flow cytometry for cell surface expression analysis

  • Immunohistochemistry/immunofluorescence for tissue localization

  • ELISA for quantitative protein measurements

• Functional expression assessment:

  • Calcium mobilization assays upon ligand stimulation

  • cAMP accumulation assays to measure receptor activation

  • Electrophysiological recordings in expression systems

When performing immunodetection, recombinant OR2H1 IgG can be conjugated to fluorophores like phycoerythrin (PE) for enhanced sensitivity. For tissue samples, optimization of antigen retrieval protocols is essential to overcome potential epitope masking in fixed tissues .

What are the known ligands for OR2H1 and how can receptor-ligand interactions be measured?

While comprehensive ligand screening for OR2H1 remains ongoing, several approaches are used to identify and characterize ligand interactions:

• Calcium flux assays:

  • Transfect cells with OR2H1 and a calcium-sensitive reporter (e.g., GCaMP)

  • Expose to potential ligands and measure fluorescence changes

  • Analysis of dose-response relationships

• cAMP accumulation assays:

  • Measure changes in intracellular cAMP levels upon receptor activation

  • Use of EPAC-based FRET sensors for real-time monitoring

• Luciferase reporter assays:

  • Coupling OR2H1 activation to reporter gene expression

  • Quantitative readout of receptor function

• Surface plasmon resonance (SPR):

  • Direct measurement of binding between purified OR2H1 and potential ligands

  • Determination of binding kinetics and affinity constants

Recent studies have identified n-hexanal as a potential ligand for some olfactory receptors, though specific binding to OR2H1 requires further validation. Interestingly, n-hexanal has been identified as an inverse agonist for certain olfactory receptors, suggesting complex regulatory mechanisms within the olfactory receptor family .

How can CRISPR/Cas9 be utilized for functional studies of OR2H1?

CRISPR/Cas9-mediated gene editing provides powerful approaches for investigating OR2H1 function:

• For OR2H1 ablation:

  • Design specific crRNA targeting OR2H1 (e.g., GACAGCCACGTATCGGTCAA)

  • Reconstitute crRNA in nuclease-free buffer and anneal with tracrRNA

  • Mix with Cas9 protein to form ribonucleoproteins (RNPs)

  • Deliver to target cells via electroporation (optimal conditions: 1,230 V, 30 ms, 2 pulses)

  • Confirm knockout via Western blot or functional assays

• For mechanistic studies:

  • Generate cell lines with OR2H1 knockout

  • Compare phenotypic changes (proliferation, metabolism, etc.)

  • Perform rescue experiments by reintroducing wild-type or mutant OR2H1

• For structure-function analysis:

  • Create precise point mutations in key domains

  • Evaluate effects on receptor trafficking, ligand binding, and signaling

CRISPR/Cas9-mediated ablation of OR2H1 has revealed its role in glucose metabolism in certain cancer cell lines, demonstrating the utility of this approach for uncovering non-canonical functions of olfactory receptors .

How can OR2H1 be utilized as a target for chimeric antigen receptor (CAR) T cell therapy?

OR2H1 presents a promising target for CAR T cell therapy against solid tumors due to its differential expression pattern. The methodology for developing OR2H1-targeted CAR T cells includes:

• CAR construct design:

  • Identify antibody fragments recognizing the extracellular domain of OR2H1 using phage display library screening

  • Design CAR construct with:

    • Olfactory receptor signal peptide

    • OR2H1 single-chain variable fragment (scFv)

    • Glycine/serine spacer

    • CD8α hinge and transmembrane domains

    • Intracellular signaling domains (4-1BB and CD3ζ)

• Expression validation:

  • Clone construct into retroviral vectors

  • Transduce T cells and confirm expression via flow cytometry

  • Validate specificity using OR2H1-expressing and non-expressing cell lines

• Functional assessment:

  • Cytotoxicity assays against OR2H1-positive tumor cells

  • Measurement of cytokine production (IFNγ, IL-2)

  • In vivo tumor models to evaluate efficacy and safety

Studies have demonstrated that OR2H1-targeted CAR T cells exhibit specific cytotoxicity against OR2H1-expressing tumor cells both in vitro and in vivo, suggesting potential clinical applications. The limited expression pattern of OR2H1 in normal tissues (primarily testis) suggests a favorable safety profile for clinical translation .

What role does OR2H1 play in cancer metabolism and how can this be investigated?

Recent findings suggest OR2H1 may influence cancer cell metabolism, particularly glucose utilization. Methodological approaches to investigate this include:

• Glucose uptake assessment:

  • Use fluorescent glucose analogs (e.g., 2-NBDG) to measure uptake in cells with or without OR2H1 expression

  • Compare wild-type cells with OR2H1-knockout cells generated via CRISPR/Cas9

• Metabolic profiling:

  • Perform extracellular flux analysis (Seahorse) to measure glycolytic rate and oxidative phosphorylation

  • Conduct stable isotope labeling experiments to track glucose fate in cellular metabolism

• Mechanistic studies:

  • Investigate downstream signaling pathways using phosphoproteomic analysis

  • Examine regulation of key metabolic enzymes and transporters

  • Explore potential interactions with established metabolic regulators

• Therapeutic implications:

  • Evaluate synergistic effects between OR2H1 targeting and metabolic inhibitors

  • Assess tumor growth in vivo following OR2H1 ablation or inhibition

CRISPR/Cas9-mediated ablation of OR2H1 has demonstrated impaired tumor growth in preclinical models, supporting the therapeutic potential of targeting this receptor. Understanding the metabolic functions of OR2H1 may reveal novel vulnerabilities in OR2H1-expressing tumors that could be exploited therapeutically .

How does OR2H1 expression in tumors compare to normal tissues, and what techniques provide the most reliable expression profiling?

Comprehensive expression profiling of OR2H1 requires multi-platform validation:

• Transcriptomic analysis:

  • RT-qPCR analysis across normal tissues and tumor samples

  • RNA-Seq data from cancer genomics databases (TCGA, ICGC)

  • Single-cell RNA-Seq for cellular heterogeneity assessment

• Protein-level validation:

  • Western blot analysis with validated antibodies

  • Immunohistochemistry on tissue microarrays

  • Flow cytometry for cell line characterization

• Tissue distribution findings:

  • Limited expression in normal tissues, primarily restricted to testis

  • Widespread expression in solid epithelial tumors including:

    • Ovarian cancers (various histologies)

    • Non-small cell lung cancers

    • Breast cancers

    • Cholangiocarcinomas

• Quantitative assessment:

  • Recombinant OR2H1 IgG specifically detects OR2H1 protein in cancer tissues

  • Positivity rates of 60 human lung cancers, 40 ovarian carcinomas, and 73 cholangiocarcinomas comparable to mRNA expression levels

  • Absence of OR2H1 staining in 58 normal tissues examined

This tumor-restricted expression pattern makes OR2H1 particularly valuable as a therapeutic target with potentially minimal off-target effects. The complementary use of RNA and protein detection methods is essential for reliable expression profiling .

What are common challenges in working with recombinant OR2H1 and how can they be addressed?

Researchers frequently encounter several challenges when working with OR2H1:

• Poor expression and inclusion body formation:

  • Solution: Optimize expression conditions (temperature, induction time)

  • Use solubility-enhancing fusion tags (MBP, SUMO)

  • Explore refolding protocols for inclusion body recovery

• Inefficient membrane trafficking:

  • Solution: Utilize the TAR-Tat system for transcriptional enhancement

  • Co-express with trafficking enhancers (RTPs, REEPs)

  • Optimize signal peptide sequences

• Protein instability:

  • Solution: Include stabilizing agents in buffers (glycerol, trehalose)

  • Store in aliquots to avoid freeze-thaw cycles

  • Maintain strict temperature control during purification

• Non-specific antibody binding:

  • Solution: Validate antibodies using knockout controls

  • Optimize blocking conditions to reduce background

  • Consider epitope-tagged versions for detection

• Variability in functional assays:

  • Solution: Standardize cell density and passage number

  • Include positive and negative controls in each experiment

  • Validate assay conditions with known olfactory receptor ligands

Detailed troubleshooting guides have been developed by experienced research groups, emphasizing the importance of systematic optimization approaches when working with challenging membrane proteins like OR2H1 .

How can researchers enhance transcriptional efficiency of OR2H1 using the TAR-Tat system?

The TAR-Tat system provides a powerful approach for enhancing OR2H1 expression:

• System components:

  • TAR (Trans-Activation Response) element: Placed upstream of the OR2H1 gene

  • Tat (Trans-Activator of Transcription): HIV-derived transcriptional activator

• Implementation protocol:

  • Clone the OR2H1 gene downstream of the TAR element

  • Co-express the Tat protein in the same cells

  • The Tat protein binds to the TAR element, enhancing transcription

  • Positive feedback develops as more Tat protein is produced

• Optimization considerations:

  • Balance Tat expression levels to avoid cellular toxicity

  • Optimize the ratio of TAR-OR2H1 to Tat expression vectors

  • Consider inducible Tat expression for temporal control

• Verification of enhancement:

  • Measure OR2H1 mRNA levels via RT-qPCR

  • Assess cell surface expression via flow cytometry

  • Evaluate functional responses to potential ligands

The TAR-Tat system has demonstrated substantial improvements in both cell surface expression and functional responses of olfactory receptors, making previously undetectable responses measurable. This approach is particularly valuable for characterizing the relationship between olfactory receptors and their cognate odorants .

What are the emerging applications of OR2H1 research in precision medicine?

OR2H1 research is opening new avenues in precision medicine, particularly in oncology:

• Diagnostic applications:

  • Development of OR2H1-based biomarkers for early cancer detection

  • Integration into multi-marker panels for improved sensitivity and specificity

  • Liquid biopsy approaches targeting OR2H1 expression

• Therapeutic strategies:

  • OR2H1-targeted CAR T cell therapy for solid tumors

  • Development of OR2H1-specific antibody-drug conjugates

  • Small molecule modulators of OR2H1 signaling

• Patient stratification:

  • Identification of patient subgroups with OR2H1-high tumors

  • Correlation with treatment response and clinical outcomes

  • Integration with multi-omics data for comprehensive profiling

• Resistance mechanisms:

  • Investigation of OR2H1 regulation in treatment-resistant tumors

  • Exploration of combination therapies targeting OR2H1 and complementary pathways

  • Development of strategies to overcome resistance to OR2H1-targeted therapies

The tumor-specific expression pattern of OR2H1 makes it particularly promising for precision oncology applications with potentially limited off-target effects. Ongoing research is focused on translating these findings into clinical applications .

What computational approaches can advance our understanding of OR2H1 structure and function?

Computational methods provide valuable insights into OR2H1 biology:

• Structural modeling:

  • Homology modeling based on resolved GPCR structures

  • Molecular dynamics simulations to explore conformational dynamics

  • Virtual screening for potential ligands and interaction partners

• Machine learning applications:

  • Prediction of ligand-binding properties

  • Classification of tumor samples based on OR2H1 expression patterns

  • Integration of multi-omics data to identify regulatory networks

• Systems biology approaches:

  • Network analysis to identify OR2H1 signaling pathways

  • Genome-wide association studies linking OR2H1 variants to phenotypes

  • Multi-scale modeling of OR2H1 function in cellular contexts

• Evolutionary analysis:

  • Comparative genomics across species to identify conserved domains

  • Analysis of selection pressures on OR2H1 sequences

  • Identification of functionally important residues

These computational approaches complement experimental methods and provide testable hypotheses for further investigation. The integration of computational and experimental approaches is particularly valuable for understanding complex signaling systems like olfactory receptors .