Recombinant Human Putative L-type amino acid transporter 1-like protein MLAS (SLC7A5P1)

What is the relationship between SLC7A5 (LAT1) and SLC7A5P1?

SLC7A5, commonly known as LAT1 (L-type amino acid transporter 1), is a Na+-independent amino acid antiporter with broad substrate specificity towards large neutral amino acids such as leucine, tyrosine, and tryptophan . SLC7A5P1 (putative L-type amino acid transporter 1-like protein MLAS) is considered a related pseudogene or variant of SLC7A5. While SLC7A5 forms a heterodimeric complex with CD98 heavy chain (CD98hc, also known as 4F2hc or SLC3A2) , the functional characteristics of SLC7A5P1 remain less characterized in current literature.

What is the structural organization of SLC7A5?

SLC7A5 belongs to the APC (Amino acid-Polyamine-organoCation) superfamily and forms a heterodimeric amino acid transporter by interacting with glycoprotein CD98 (SLC3A2) via a disulfide bond . Structural and functional studies have identified key residues critical for substrate binding and transport:

• F252 functions as the substrate gate, with its aromaticity essential for this role

• S342 and C335 are crucial for histidine binding from the external side

• C407 is involved in substrate binding from the internal side

SLC7A5 is the sole transport-competent subunit of the heterodimer, while CD98 does not exhibit intrinsic transport function .

What expression systems are optimal for recombinant SLC7A5/SLC7A5P1 production?

Several expression systems have been successfully employed for SLC7A5 production:

• Bacterial expression: Human SLC7A5 has been successfully expressed in E. coli for large-scale purification and functional characterization

• Mammalian cell expression: For studies requiring post-translational modifications

• Lentiviral expression systems: For stable integration into mammalian cells, using vectors such as pSLenti-U6-shRNA-CMV-EGFP-F2A-Puro-WPRE for human cells or hU6-MCS-CBh-gcGFP-IRES-puromycin for mouse cells

When designing constructs, consideration of fusion tags (His, FLAG) is important for downstream purification steps. For SLC7A5P1, similar expression strategies can be employed with sequence-specific modifications.

What methodologies are available for modulating SLC7A5 expression in experimental models?

Researchers can modulate SLC7A5 expression through several approaches:

• RNA interference: Short hairpin RNA (shRNA) can be delivered via lentiviral vectors to establish stable knockdown models. The following sequences have been employed successfully:

  Table 1: shRNA Sequences for SLC7A5 Knockdown

  Species	Type	Sequence (5′-3′)
  Human	Negative control	CCTAAGGTTAAGTCGCCCTCG
  Human	SLC7A5 shRNA1	GGAAGGGTGATGTGTCCAA
  Human	SLC7A5 shRNA2	CCAATCTAGATCCCAACTT
  Mouse	Negative control	TTCTCCGAACGTGTCACGT

  Knockdown efficiency should be verified through western blotting after puromycin selection (typically 2 μg/ml for 5 days followed by maintenance with 1 μg/ml) .

• Overexpression systems: Plasmids encoding SLC7A5 can be electroporated or transfected into cells

• CRISPR-Cas9 gene editing: For complete knockout or precise genomic modifications

• Pathway modulators: Co-expression with pathway components like Rheb can help dissect functional relationships between SLC7A5 and signaling pathways such as mTOR

What assays are recommended for measuring SLC7A5 transport activity?

Several complementary approaches can be used to assess SLC7A5 transport function:

• Proteoliposome-based transport assays: Purified SLC7A5 is incorporated into phospholipid vesicles, allowing precise control of substrate concentrations on both sides of the membrane

• Indirect measurement through mTOR pathway: Since SLC7A5-mediated leucine transport activates mTOR signaling, phosphorylation of S6 (pS6) can serve as an indirect readout of transport activity

• Radiolabeled or fluorescent amino acid uptake assays: Using labeled substrates (particularly histidine, tyrosine, or leucine) to measure transport kinetics

• Inhibitor-based approaches: Mercury compounds (both inorganic HgCl2 and organic Methyl-Hg) strongly inhibit LAT1-mediated transport by binding to cysteine residues and can be used to validate transport specificity

• Mass spectrometry: For quantitative analysis of intracellular amino acid levels following manipulation of SLC7A5/SLC7A5P1 expression

How does SLC7A5 regulate the mTOR pathway?

SLC7A5 is a critical regulator of the mTOR (mechanistic target of rapamycin) pathway through several mechanisms:

• Leucine transport: SLC7A5 mediates uptake of leucine, which is essential for mTOR activation

• Signaling consequences: SLC7A5 knockdown results in approximately 29% decrease in phosphorylated S6 (pS6), a downstream target of mTORC1

• Rescue mechanisms: The effects of SLC7A5 knockdown on mTORC1 activity can be partially rescued by overexpression of Rheb, a direct activator of mTORC1 that can function in the absence of leucine

• Feedback regulation: While SLC7A5 regulates mTOR activity, evidence suggests mTORC1 can also regulate SLC7A5 expression in certain contexts, indicating a potential feedback mechanism

These findings highlight SLC7A5 as a key metabolic regulator of cellular signaling pathways through its transport function.

What role does SLC7A5 play in dendrite development and neuronal survival?

SLC7A5 is critical for neuronal development and survival, particularly in the following aspects:

• Granule cell survival: In mouse studies, SLC7A5 knockdown resulted in 70% fewer granule cells (GCs) in the olfactory bulb by postnatal day 30 (P30), with this phenotype worsening by P70 when almost no labeled GCs remained

• Dendrite complexity: SLC7A5 knockdown decreases dendrite complexity, with approximately 53% fewer total dendrite crossings compared to controls

• mTOR-dependent mechanisms: These neuronal defects can be partially rescued by Rheb overexpression, indicating that SLC7A5 supports neuronal development through mTOR pathway activation

• Clinical relevance: Patients with SLC7A5 mutations have microcephaly, and neurons do not develop properly in Slc7A5 knockout mice

These findings suggest critical consideration of SLC7A5/SLC7A5P1 in neurological research contexts.

How does SLC7A5 contribute to metabolic regulation in different cell types?

SLC7A5 regulates cellular metabolism through several mechanisms:

• Amino acid homeostasis: By transporting essential amino acids, SLC7A5 maintains intracellular pools required for protein synthesis

• Insulin production: Low expression of SLC7A5 in β-cells induces a strong reduction in insulin production

• Cell-type specific effects:

  • In muscle: Low insulin concentrations upregulate LAT1 expression following mTORC1 activation

  • In diabetes: Increased glucose levels can down-regulate SLC7A5 expression, potentially contributing to sarcopenia

  • In retina: Glucose deprivation induces up-regulation of SLC7A5

• T-cell metabolism: SLC7A5 is highly expressed in activated T cells and upregulated by IL-2, supporting their metabolic demands during activation

These diverse roles position SLC7A5 as a central metabolic regulator whose function should be considered within the specific cellular context being studied.

What is the significance of SLC7A5 in cancer?

SLC7A5 plays multiple roles in cancer biology and progression:

• Prognostic value: High expression of SLC7A5 mRNA and protein is associated with:

  • Larger tumor size and higher grade

  • Poor patient outcome in breast cancer, particularly in triple negative, HER2+, and luminal B subtypes

  • Independent risk factor for shorter breast-cancer-specific survival in ER+ high-proliferation tumors

• Cell cycle regulation: Inhibition of SLC7A5 reduces ovarian cancer cell proliferation through G2/M cell cycle arrest

• Immune evasion: SLC7A5 regulates tryptophan uptake in ovarian cancer, affecting aryl hydrocarbon receptor nuclear entry, which in turn downregulates PD-L1 expression

• Metabolic biomarkers: Dysregulation of tryptophan metabolism and upregulation of kynurenine in plasma have been demonstrated as unfavorable prognostic factors for progression-free survival in ovarian cancer patients

• Genetic alterations: Copy number variations, with SLC7A5 amplification in 0.3-0.6% and deletion in 56-68% of breast cancer cases

How does SLC7A5 influence drug transport across the blood-brain barrier?

SLC7A5 is a critical determinant of drug penetration into the central nervous system:

• Transport of therapeutic compounds: SLC7A5 transports amino acid derivatives including:

  • L-DOPA (used in Parkinson's disease treatment)

  • Melphalan (anti-cancer agent)

  • Gabapentine (anticonvulsant)

• Drug design implications: Understanding SLC7A5's substrate specificity can inform the design of novel drugs capable of crossing the blood-brain barrier

• Competitive transport: Drugs that are SLC7A5 substrates may compete with natural amino acids, potentially affecting amino acid availability in the brain

• Therapeutic targeting: SLC7A5 is recognized as an important target for developing novel blood-brain barrier-crossing drugs and is relevant for Parkinson's disease management

What are the effects of SLC7A5 on immune function and potential immunotherapeutic applications?

SLC7A5 has significant implications for immune function and immunotherapy:

• T cell activation: SLC7A5 is highly expressed in activated T cells and is critical for their metabolic reprogramming during immune responses

• Cytokine regulation: The cytokine IL-2 upregulates SLC7A5 expression in T lymphocytes, while in rheumatoid arthritis, IL-17 promotes SLC7A5-mediated fibroblast migration

• Immune checkpoint modulation: In ovarian cancer, SLC7A5 inhibition blocks intracellular aryl hydrocarbon receptor nuclear entry, which downregulates PD-L1 expression

• Therapeutic potential: Targeting SLC7A5 may provide a novel approach for immunotherapeutic management of ovarian cancer patients

• Diagnostic applications: Dysregulation of tryptophan metabolism could potentially serve as a diagnostic biomarker for ovarian cancer

These findings suggest that researchers should consider the dual effects of SLC7A5 targeting on both cancer cells and immune cells within the tumor microenvironment.

What are the key methodological considerations when studying SLC7A5 versus SLC7A5P1?

When investigating SLC7A5 and SLC7A5P1, researchers should consider:

• Expression verification: Confirm specific expression using:

  • Reverse transcription-PCR (RT-PCR)

  • In situ hybridization (ISH)

  • bDNA fluorescence in situ hybridization (FISH) for precise localization

• Structural differences: Design experiments that account for potential structural variations between SLC7A5 and SLC7A5P1

• Functional redundancy: Assess whether SLC7A5P1 compensates for SLC7A5 deficiency or has distinct functions

• Recombinant systems: When using recombinant proteins, consider:

  • Optimal expression systems (bacterial vs. mammalian)

  • Purification strategies that maintain protein stability and function

  • Functional verification using proteoliposome-based transport assays

• Knockout/knockdown approaches: Design targeted strategies specific to each gene to avoid off-target effects

How do site-directed mutations affect SLC7A5 transport function?

Structure-function analysis through site-directed mutagenesis has revealed:

• Gate residues: F252 plays a critical role in substrate gate opening, with its aromaticity being essential for this function

• External substrate binding: S342 and C335 are crucial for histidine binding from the external side of the protein

• Internal substrate binding: C407 is involved in substrate binding from the internal side

• Mercury sensitivity: Both inorganic HgCl2 and organic Methyl-Hg strongly inhibit LAT1-mediated transport by binding to cysteine residue(s)

• Heterodimer formation: Mutations affecting the interaction with CD98 can impact surface expression and transport activity

Researchers designing mutation studies should consider these residues as starting points for further functional analysis of SLC7A5P1.

What are the technical challenges in studying the SLC7A5/CD98 heterodimer?

The heterodimeric nature of SLC7A5/CD98 presents several technical challenges:

• Purification complexity: The disulfide linkage between SLC7A5 and CD98 requires non-reducing conditions during certain purification steps

• Reconstitution considerations: Decisions about whether to reconstitute the full heterodimer or focus on SLC7A5 alone will depend on specific research questions

• Structural studies: The heterodimeric structure adds complexity to structural determination efforts, necessitating techniques like cryo-electron microscopy

• Interaction analysis: Understanding the binding interface requires specialized approaches like crosslinking mass spectrometry or hydrogen-deuterium exchange

• Distinguishing functions: Experiments must be designed to differentiate between SLC7A5 transport function and potential CD98-mediated signaling

• Physiological relevance: Results from systems using SLC7A5 alone must be interpreted cautiously when extrapolating to in vivo contexts where the heterodimer predominates

How can apparent contradictions in the literature regarding SLC7A5 function be reconciled?

Several contradictions or uncertainties exist in SLC7A5 research:

• Substrate preference evolution: While early studies identified SLC7A5 as primarily a leucine transporter, more recent work has highlighted its significant role in histidine transport, which was initially reported but later overlooked

• Transport asymmetry: Research indicates directional preferences, with some amino acids being bidirectionally transported while others preferentially move inward

• Regulatory mechanisms: The relative importance of different regulatory factors (cytokines, glucose, insulin, microRNAs, DNA methylation) varies across cell types and contexts

• Cancer subtype specificity: The prognostic significance of SLC7A5 differs across cancer molecular subtypes, being particularly relevant in highly proliferative ER+/luminal B and HER2+ breast cancers

• c-MYC relationship: The correlation between SLC7A5 and c-MYC is significant specifically in luminal B tumors only, suggesting context-dependent interactions

Researchers should address these contradictions by:

• Carefully controlling experimental conditions

• Specifying the cellular context of their studies

• Directly comparing multiple amino acid substrates in the same experimental system

• Considering both transport function and regulatory mechanisms simultaneously