Recombinant Human Transmembrane protein 14A (TMEM14A)

What is the basic structure of TMEM14A?

TMEM14A is an integral transmembrane protein consisting of 99 amino acids organized into three transmembrane domains. Its structure has been identified using nuclear magnetic resonance spectroscopy techniques . As a membrane protein, it exhibits distinct topological features that enable its localization in cellular membranes, particularly in mitochondria as reported in some studies .

What are the known physiological functions of TMEM14A?

TMEM14A has two primary documented functions based on current research. First, it plays a role in suppressing Bax-mediated apoptosis by preventing loss of mitochondrial membrane potential . Second, it serves as a protective factor in maintaining the integrity of the glomerular filtration barrier in the kidney . Studies show that TMEM14A is primarily expressed by podocytes in the kidney, and its expression decreases before the onset of proteinuria in animal models .

What cell types predominantly express TMEM14A?

Research indicates that TMEM14A is primarily expressed in podocytes within the kidney glomeruli . It has also been studied in various cell lines including immortalized podocytes, HEK293 cells, and human umbilical vein endothelial cells (HUVECs) . In cancer research, TMEM14A expression has been documented in ovarian cancer cells, as well as previously reported in hepatocellular carcinoma and colorectal cancer cell types .

What are the established methods for manipulating TMEM14A expression in experimental settings?

Several validated approaches exist for modulating TMEM14A expression:

• RNA interference (RNAi): siRNAs targeting distinctive regions of human TMEM14A have been successfully used to silence expression. Specific sequences reported include:

  • siTMEM14A-1: TAGCACTGTCACCTCTAATAT

  • siTMEM14A-2: AAGCTTAAACTACAACTTGTC

  • siTMEM14A-3: AAGTGGAGTTCACAGAATGAT

• Lentiviral-mediated vector systems: For both silencing and overexpression studies, lentiviral plasmids (such as pLKO.1) have been effectively employed with transfection rates over 80% in cell culture models .

• Morpholino injections: In zebrafish embryo models, morpholinos have been used to block tmem14a mRNA translation, providing an in vivo approach to study functional consequences of TMEM14A knockdown .

The efficacy of these manipulations should be verified through RT-qPCR or western blot analysis to confirm successful modulation of expression levels.

How can TMEM14A protein localization be assessed in tissue samples?

Immunohistochemical staining is the predominant method for assessing TMEM14A expression and localization in tissues. For quantification in both rat and human tissue samples, researchers have employed a semiquantitative approach with scoring systems. A validated scale ranges from 0-4, where:

• 0: No podocyte staining

• 1: 0%-10% of podocytes showing staining

• 2: 10%-30% of podocytes showing staining

• 3: 30%-60% of podocytes showing staining

• 4: >60% of podocytes showing staining

This scoring should be performed in a blinded manner to prevent bias, and appropriate positive and negative controls should be included to validate staining specificity.

What animal models are suitable for studying TMEM14A function?

Two primary animal models have been validated for TMEM14A research:

• Rat models:

  • Dahl rats develop spontaneous proteinuria and show diminished TMEM14A expression compared to spontaneously hypertensive rats (SHR), making them suitable for studying TMEM14A in kidney disease .

  • Expression patterns can be compared across different age points (2, 4, 6, 8, and 10 weeks) to correlate with disease progression .

• Zebrafish embryo model:

  • The zebrafish homologue of TMEM14A (zgc:163080) can be knocked down using morpholino injection .

  • Glomerular filtration barrier integrity can be assessed by injecting fluorescent dextran tracers (3 kDa and 70 kDa) and quantifying their reabsorption in proximal tubular epithelial cells .

  • Puromycin aminonucleoside (PAN) injected zebrafish serve as a validated positive control for inducing proteinuria .

What is the role of TMEM14A in ovarian cancer progression?

TMEM14A has been identified as a potential oncogenic factor in ovarian cancer with several key functions:

• Apoptosis inhibition: TMEM14A inhibits ovarian cancer cell apoptosis, contributing to cancer cell survival .

• Metabolic reprogramming: It accelerates energy metabolism in cancer cells, including both glycolysis and oxygen respiration, which can be measured using a Seahorse XF24 analyzer .

• Molecular interactions: TMEM14A is positively correlated with c-MYC expression, suggesting a potential regulatory relationship that contributes to cancer progression .

Experimental evidence indicates that knockdown of TMEM14A contributes to suppressing the growth of human ovarian cancer cells by blocking glycolytic activity, suggesting a metabolic mechanism underlying its oncogenic effects .

How can TMEM14A expression be correlated with patient outcomes in cancer research?

Researchers have established methods to correlate TMEM14A expression with clinical outcomes:

A study involving 120 ovarian cancer patients (stages II-IV) demonstrated that TMEM14A expression was positively correlated with mortality rate, suggesting its potential as both a diagnostic and prognostic biomarker .

What cellular pathways interact with TMEM14A in cancer cells?

Research has identified several key pathways and interactions:

• c-MYC pathway: Chromatin immunoprecipitation assays have demonstrated connections between TMEM14A and c-MYC, with overexpression of c-Myc rescuing the functional effects of TMEM14A manipulation .

• Apoptotic pathways: TMEM14A suppresses Bax-mediated apoptosis and prevents loss of mitochondrial membrane potential, suggesting interactions with intrinsic apoptotic machinery .

• Energy metabolism: TMEM14A influences both glycolysis and oxidative phosphorylation in cancer cells, indicating involvement in metabolic regulation pathways critical for cancer cell survival and proliferation .

These pathway interactions present potential targets for developing combination therapy approaches for cancer treatment.

How does TMEM14A contribute to glomerular filtration barrier integrity?

TMEM14A has been identified as a critical protein for maintaining glomerular filtration barrier integrity through several mechanisms:

• Podocyte function: TMEM14A is primarily expressed by podocytes, specialized cells that form an essential component of the filtration barrier .

• Expression patterns in disease:

  • In spontaneously proteinuric rat models, glomerular TMEM14A expression diminishes before the onset of proteinuria

  • In various proteinuric renal diseases, an increase in glomerular TMEM14A expression is observed, suggesting a potential compensatory response

• Functional evidence: Knockdown of tmem14a mRNA translation in zebrafish embryos results in proteinuria without affecting tubular reabsorption, confirming its direct role in maintaining barrier function .

The anti-apoptotic function of TMEM14A may be particularly relevant, as podocyte apoptosis has been described as a pathophysiological process in various proteinuric renal diseases, especially diabetic nephropathy .

What experimental readouts can quantify TMEM14A's effects on kidney function?

Researchers have established several quantitative approaches:

• Zebrafish embryo proteinuria model:

  • Inject fluorescent dextran tracers (3 kDa and 70 kDa)

  • Quantify reabsorption droplets in proximal tubule cells

  • Compare 3 kDa droplets (marker of tubular reabsorption) with 70 kDa droplets (marker of glomerular permeability)

  • A higher number of 70 kDa reabsorption droplets indicates loss of glomerular filtration barrier integrity

• Expression analysis in rat models:

  • Compare glomerular mRNA expression using RT-qPCR with appropriate housekeeping genes (e.g., Hprt1)

  • Evaluate protein expression through semiquantitative immunohistochemistry scoring

  • Analyze expression changes across different age points before and after onset of proteinuria

These methods allow for both functional assessment and molecular quantification of TMEM14A's effects.

How should discrepancies between TMEM14A expression patterns in different diseases be interpreted?

Researchers face an interesting paradox where TMEM14A shows increased expression in cancer (promoting disease) but decreased expression in kidney disease before proteinuria onset (preceding disease). When confronting such discrepancies:

• Tissue-specific function analysis:

  • Analyze expression in multiple cell types using single-cell RNA sequencing

  • Perform co-expression analysis with tissue-specific transcription factors

  • Examine potential splice variants or post-translational modifications

• Context-dependent signaling:

  • Investigate interaction partners in different cellular contexts

  • Examine subcellular localization differences (mitochondrial in cancer versus potentially membrane-associated in podocytes)

  • Consider compensatory mechanisms that may upregulate expression in response to disease processes

The differential expression patterns highlight the complexity of TMEM14A biology and suggest that its functions are highly context-dependent, requiring targeted analysis in each tissue system.

What are the current limitations in TMEM14A research methodologies?

Several methodological challenges exist in the current research landscape:

• Protein detection issues:

  • Limited availability of validated antibodies for TMEM14A

  • Challenges in membrane protein isolation and purification

  • Difficulties in distinguishing between different potential isoforms

• Functional assessment limitations:

  • Incomplete understanding of interaction partners

  • Limited structural information beyond basic transmembrane topology

  • Lack of specific pharmacological modulators to target TMEM14A function

• Translation challenges:

  • Limited human data compared to model systems

  • Unclear relevance of zebrafish and rat findings to human pathophysiology

  • Need for improved disease models that better recapitulate human conditions

Addressing these limitations requires developing improved tools for TMEM14A detection, characterization, and modulation in different experimental settings.

What emerging technologies could advance TMEM14A research?

Several cutting-edge approaches could significantly enhance understanding of TMEM14A:

• CRISPR-Cas9 genome editing:

  • Generation of knockout and knock-in models for precise functional assessment

  • Introduction of tagged versions of TMEM14A for improved detection and localization studies

  • Creation of conditional knockout models to study tissue-specific effects

• Organoid and microphysiological systems:

  • Development of kidney organoids to study TMEM14A in a more physiologically relevant context

  • Cancer spheroids for three-dimensional assessment of TMEM14A effects on tumor growth

  • Organ-on-chip approaches to examine dynamic responses to TMEM14A modulation

• Advanced imaging techniques:

  • Super-resolution microscopy for precise subcellular localization

  • Live-cell imaging with fluorescently tagged TMEM14A to monitor trafficking and dynamics

  • Correlative light and electron microscopy to connect ultrastructural changes with TMEM14A function

These technological approaches would provide more nuanced insights into TMEM14A biology and potentially reveal novel therapeutic targets.