Recombinant Human Transmembrane protein 182 (TMEM182)

What is the tissue-specific expression pattern of TMEM182?

TMEM182 exhibits a highly specific expression pattern, being predominantly expressed in skeletal muscle and adipose tissue . This tissue specificity has significant implications for experimental design:

• When studying non-muscle or non-adipose tissues, expression levels will likely be minimal

• TMEM182 can serve as a useful marker for myogenic differentiation

• Experiments targeting TMEM182 function should focus on these specific tissue types

RNA sequencing, quantitative real-time PCR, and immunofluorescence approaches have all confirmed this expression pattern during myoblast differentiation studies .

How is TMEM182 expression regulated during muscle development?

TMEM182 is dramatically upregulated during myogenesis through a transcriptional mechanism involving the myogenic regulatory factor MyoD1 . This regulation has been validated through:

• Dual-luciferase reporter assays identifying the promoter region of the TMEM182 gene

• Chromatin immunoprecipitation assays confirming direct MyoD1 binding to the TMEM182 promoter

• Expression profiling showing temporal correlation with myogenic differentiation stages

This regulatory relationship provides researchers with a potential tool for manipulating TMEM182 expression by modulating MyoD1 activity in experimental systems .

What is the functional role of TMEM182 in muscle biology?

• TMEM182 inhibits myoblast differentiation and fusion in vitro

• Overexpression of TMEM182 induces muscle fiber atrophy in vivo

• TMEM182 delays muscle regeneration following injury

• TMEM182 knockout mice exhibit significant increases in body weight, muscle mass, muscle fiber number, and muscle fiber diameter

• Muscle regeneration is accelerated in TMEM182-knockout mice

These findings suggest TMEM182 may serve as a molecular brake on excessive muscle growth and differentiation, maintaining homeostasis through negative feedback .

What animal models have been established for studying TMEM182 function?

Two primary animal models have been successfully employed to study TMEM182 function in vivo :

• Chicken model:

  • Used primarily for overexpression studies

  • Enables analysis of TMEM182 effects on developing muscle

  • Provides a system for studying the impact on muscle fiber morphology

• TMEM182-knockout mice:

  • Generated using the CRISPR-Cas9 genome-editing system in C57BL/6 background

  • Created using sgRNA pairs (sgRNA1: CGATGTTCTTAGTCTCAACGAGG and sgRNA2: ACTAGATGAAACCGTAGGTGTGG)

  • Targeted deletion of a 2517 bp genomic region containing exon 2, intron 2, and exon 3

  • Exhibits increased muscle mass and enhanced regenerative capacity

Primary myoblasts isolated from these animal models have also proven valuable for in vitro studies of TMEM182 function in myoblast differentiation and fusion .

What are the recommended protocols for detecting TMEM182 protein in experimental systems?

For effective detection of TMEM182 in research applications, the following methodologies have been validated :

Immunofluorescence protocol for TMEM182 detection:

• Wash cells with phosphate-buffered saline (PBS)

• Incubate in blocking buffer (3% bovine serum albumin/PBS) for 15 minutes

• Incubate with anti-TMEM182 antibody (1:200, Abmart) on ice

• Fix with 4% PFA/PBS

• Incubate with appropriate secondary antibody

• Counterstain nuclei with DAPI or Hoechst

• Visualize using confocal microscopy (e.g., Leica TCS SP8)

Western blot detection:

• Use anti-TMEM182 monoclonal antibody (1:500, customized by Abmart)

• The antibody should be raised against recombinant TMEM182 protein

• Expected molecular weight: approximately 25.7 kDa

What protein interactions are critical for TMEM182 function?

TMEM182 directly interacts with integrin beta 1 (ITGB1), which is essential for its function in regulating muscle development . This interaction:

• Requires an extracellular hybrid domain of ITGB1 (amino acids 387-470)

• Depends on a conserved region (amino acids 52-62) within the large extracellular loop of TMEM182

• Modulates ITGB1 activation by influencing the association between ITGB1 and laminin

• Regulates downstream ITGB1 intracellular signaling

This critical protein-protein interaction has been confirmed through multiple methodologies including co-immunoprecipitation, mass spectrometry, and functional assays .

How does TMEM182 influence intracellular signaling pathways?

TMEM182 regulates key signaling pathways in muscle cells primarily through its interaction with ITGB1 :

Mechanistically, TMEM182 appears to modulate these pathways by:

• Coordinating the association between ITGB1 and extracellular matrix components, particularly laminin

• Attenuating downstream signaling events that promote myogenic differentiation

• Potentially interfering with integrin clustering and focal adhesion formation

Researchers investigating muscle signaling should consider TMEM182 as an important modulator of these pathways, particularly in contexts of integrin-mediated signaling .

How can TMEM182 be genetically manipulated for functional studies?

Several proven strategies exist for genetic manipulation of TMEM182 :

Knockout approaches:

• CRISPR-Cas9 system using paired sgRNAs to delete critical exons

• Validation through PCR amplification with TMEM182-specific primers

• Phenotypic confirmation through protein expression analysis

Overexpression approaches:

• Cloning TMEM182 coding sequence (NCBI Reference Sequence: XM_416920.6 for chicken, NM_144632 for human) into expression vectors

• pcDNA3.1 vector for transient transfection experiments

• pWPXL lentiviral vector (Addgene) for stable integration or in vivo delivery

• Confirmation through double restriction enzyme digestion and DNA sequencing

For in vivo overexpression, lentiviral vectors carrying TMEM182 can be injected directly into muscle tissue, with subsequent analysis of the injection site for phenotypic changes .

What are the optimal conditions for working with recombinant TMEM182 protein?

When working with commercially available recombinant human TMEM182 protein, the following conditions are recommended :

Storage and stability:

• Store at -80°C for long-term preservation

• Avoid repeated freeze-thaw cycles to maintain protein integrity

• Stable for approximately 12 months when properly stored

Working conditions:

• For cell culture applications, filter the protein solution before use

• Be aware some protein loss may occur during filtration

• Typical buffer composition: 25 mM Tris-HCl, 100 mM glycine, pH 7.3, 10% glycerol

• Protein concentration typically >0.05 μg/μL as determined by microplate BCA method

• Purity >80% as determined by SDS-PAGE and Coomassie blue staining

These guidelines help ensure experimental reproducibility and optimal protein activity when working with recombinant TMEM182 .

How does TMEM182 affect muscle regeneration after injury?

TMEM182 has significant effects on muscle regeneration processes :

• TMEM182 knockout mice show accelerated skeletal muscle regeneration compared to wild-type mice

• Myogenic deletion of TMEM182 increases the binding activity of ITGB1 to laminin

• Loss of TMEM182 enhances activation of regenerative signaling pathways, including FAK-ERK and FAK-Akt axes

• TMEM182 appears to function as a negative regulator of the regenerative process

These findings suggest that temporary inhibition of TMEM182 might represent a potential therapeutic strategy to enhance muscle regeneration following injury or in degenerative muscle conditions .

What is the correlation between TMEM182 expression and muscle atrophy or hypertrophy?

The relationship between TMEM182 expression and muscle size regulation has been established through several experimental approaches :

Quantitative analysis of muscle fiber cross-sectional area (CSA) in gastrocnemius muscle demonstrated that modulation of TMEM182 levels directly impacts muscle fiber size. These measurements were performed using NIS-Elements BR software (Nikon) for accurate quantification .

The negative correlation between TMEM182 expression and muscle hypertrophy suggests it may be a therapeutic target in conditions characterized by muscle wasting or insufficient growth.