Recombinant Human Transmembrane protein 198 (TMEM198)

What is the basic structure and localization of TMEM198?

TMEM198 (transmembrane protein 198) is a protein-coding gene located on chromosome 2 that encodes a seven-transmembrane protein . Previously relatively uncharacterized, it has now been identified as a membrane scaffold protein with important signaling functions . The protein has both N-terminal extracellular and C-terminal cytoplasmic domains, with the latter being particularly important for its signaling activities .

The protein features several key domains:

• Signal peptide (N-terminal)

• Seven transmembrane domains

• Intracellular loops that include functionally important residues

• Cytoplasmic C-terminal domain that interacts with kinases

TMEM198 localizes to the plasma membrane where it can interact with other membrane proteins involved in signaling pathways, particularly components of the Wnt pathway .

What is known about TMEM198 gene expression patterns?

TMEM198 exhibits distinctive expression patterns that vary by developmental stage and tissue type. During Xenopus embryogenesis, both maternal and zygotic tmem198 mRNAs are widely distributed throughout the ectoderm and mesoderm . This broad distribution suggests fundamental roles in early development across multiple tissue types.

The gene appears to be conserved across species, with homologs identified in various vertebrates. Expression data indicates that TMEM198 is not restricted to embryonic development but continues to be expressed in adult tissues, suggesting ongoing functions in tissue homeostasis .

How does TMEM198 differ from other TMEM family proteins?

TMEM198 belongs to a larger family of transmembrane proteins, but has specific structural and functional characteristics that distinguish it from other family members. Also known as TMEM198A, it has a specific function in Wnt signaling that is not universally shared by other TMEM proteins .

Recent research has identified numerous TMEM family proteins with diverse functions. A study examining TMEM proteins in osteosarcoma identified 26 TMEM family genes with prognostic significance, including TMEM198, which was classified as a risk factor (hazard ratio >1) . This indicates that different TMEM proteins have evolved specialized functions despite sharing the common characteristic of spanning cellular membranes.

How does TMEM198 participate in the Wnt/β-catenin signaling pathway?

TMEM198 functions as a specific activator of LRP6 (low-density lipoprotein receptor-related protein 6) in the Wnt/β-catenin signaling pathway . The mechanism involves:

• Association with LRP6 at the plasma membrane

• Recruitment of casein kinase family proteins via its cytoplasmic domain

• Facilitation of LRP6 phosphorylation at key residues

• Promotion of LRP6 aggregation, which amplifies signaling activity

Epistatic analysis has demonstrated that TMEM198 and casein kinases are interdependent in LRP6 phosphorylation, suggesting that TMEM198 provides a crucial scaffold that positions kinases optimally for phosphorylating LRP6 . Knockdown experiments in mammalian cells have shown that TMEM198 is required for both Wnt signaling and casein kinase 1-induced LRP6 phosphorylation .

What are the key phosphorylation sites and kinases involved in TMEM198-mediated signaling?

TMEM198 primarily facilitates phosphorylation of LRP6 by recruiting casein kinase family proteins. The key elements in this process include:

• Phosphorylation sites on LRP6: TMEM198 promotes phosphorylation at specific conserved motifs (PPPSP) and adjacent residues in the intracellular domain of LRP6, which are critical for signal transduction .

• Kinases: Casein kinase 1 (CK1) family members, particularly CK1ε, are recruited by TMEM198 to phosphorylate LRP6 . The interaction between TMEM198's cytoplasmic domain and these kinases is essential for function.

• Functional domains of TMEM198: Mutagenesis studies have identified critical regions, particularly in the intracellular loops and C-terminal domain. For example, TMEM198-M2, with mutations in four amino acids in intercellular loop 3 (T168P, S171A, T172A, and T174R), shows almost complete loss of activity while maintaining normal expression and cellular distribution .

What experimental evidence supports TMEM198's function in Wnt signaling?

Multiple experimental approaches have validated TMEM198's role in Wnt signaling:

Gain-of-function experiments:

• Overexpression of TMEM198 activates Wnt-responsive reporters

• TMEM198 specifically enhances LRP6-mediated, but not other pathway-mediated, reporter activation

Loss-of-function experiments:

• siRNA-mediated knockdown of TMEM198 impairs Wnt signaling and LRP6 phosphorylation

• Target sequences used for human TMEM198 siRNA include GCGTGCAACTGATGCGGAT (siRNA-1) and GCCCATCAAACGCTTCAAT (siRNA-2)

• shRNA with target sequence GCTGTTTGTTTGGAGTCGTCT also effectively reduces TMEM198 expression

Biochemical analyses:

• Immunoprecipitation demonstrates physical association between TMEM198 and LRP6

• In vitro kinase assays confirm that TMEM198 facilitates CK1-mediated phosphorylation of LRP6

• GST pulldown experiments validate direct interactions between the cytoplasmic domain of TMEM198 and signaling components

What developmental processes require TMEM198 function?

TMEM198 plays crucial roles in several developmental processes, particularly in Xenopus embryogenesis:

• Neural crest formation: TMEM198 is required for Wnt-mediated neural crest formation, which gives rise to diverse cell types including peripheral neurons, melanocytes, and craniofacial structures .

• Anteroposterior patterning: The protein contributes to establishing the head-to-tail axis during embryonic development, a process heavily dependent on properly regulated Wnt signaling .

• Gene expression regulation: TMEM198 is particularly important for the expression of engrailed-2, a homeobox gene involved in midbrain-hindbrain boundary formation and neural development .

These developmental functions align with TMEM198's role in modulating Wnt signaling, a pathway fundamental to numerous aspects of embryonic development and tissue patterning.

How is TMEM198 implicated in disease processes?

Current research has begun to reveal connections between TMEM198 and pathological conditions:

• Cancer prognosis: TMEM198 has been identified as a risk factor (hazard ratio >1) in a transmembrane protein family gene signature for osteosarcoma prognosis . This suggests that higher expression of TMEM198 may correlate with poorer outcomes in this cancer type.

• Potential role in other Wnt-related disorders: Given its central role in Wnt signaling, TMEM198 dysfunction may contribute to other conditions where Wnt pathway dysregulation is implicated, including:

  • Developmental disorders

  • Degenerative diseases

  • Additional cancer types

The prognostic signature developed for osteosarcoma incorporated multiple TMEM family genes, with TMEM198 being one of 15 TMEM genes identified as risk factors . This finding positions TMEM198 as a potential biomarker and therapeutic target in cancer contexts.

What is known about TMEM198 in human tissues compared to model organisms?

Research on TMEM198 has been conducted in both human cells and model organisms, revealing both conserved and species-specific aspects:

Human TMEM198:

• Located on chromosome 2

• Functions in Wnt signaling and LRP6 phosphorylation in human cell lines

• Implicated in osteosarcoma prognosis

• Can be targeted effectively with siRNA sequences for functional studies

Xenopus TMEM198:

• Widely expressed in ectoderm and mesoderm during embryogenesis

• Required for neural crest formation and anteroposterior patterning

• Important for engrailed-2 expression

• Functional in experimental embryological studies through gain- and loss-of-function approaches

The conserved roles across species highlight the fundamental importance of TMEM198 in developmental processes and cellular signaling, while differences suggest potential species-specific adaptations.

What are effective approaches for manipulating TMEM198 expression in experimental systems?

Researchers have employed several strategies to modulate TMEM198 expression for functional studies:

Overexpression methods:

• Transfection of plasmid constructs containing TMEM198 coding sequences

• Addition of tags (FLAG, Myc, V5) for detection and purification

• Generation of truncated or domain-specific constructs to study structure-function relationships

Knockdown and knockout approaches:

• siRNA-mediated knockdown using validated target sequences:

  • siRNA-1: GCGTGCAACTGATGCGGAT

  • siRNA-2: GCCCATCAAACGCTTCAAT

• shRNA expression with target sequence: GCTGTTTGTTTGGAGTCGTCT

• CRISPR-Cas9 genome editing for permanent gene disruption

Mutagenesis strategies:

• Site-directed mutagenesis to create loss-of-function variants

• Domain deletion constructs to identify essential regions

• Example: TMEM198-M2 mutant (T168P, S171A, T172A, and T174R) with minimal activity but normal expression

These approaches can be applied in various experimental systems including cell lines, Xenopus embryos, and potentially other model organisms to investigate TMEM198 function.

What biochemical assays are most informative for studying TMEM198 interactions and activity?

Several biochemical techniques have proven valuable for investigating TMEM198's interactions and functions:

Protein-protein interaction assays:

• Immunoprecipitation: Effective for detecting interactions between TMEM198 and partners like LRP6 or kinases. Typically performed using anti-FLAG agarose beads (M2) or protein A/G plus Myc antibody for tagged constructs .

• GST pulldown: Useful for mapping interaction domains. The cytoplasmic domain of TMEM198 (GST-TMEM198-C) can be used to identify direct binding partners .

• Yeast two-hybrid: Can be employed to screen for novel interaction partners.

Functional assays:

• In vitro kinase assays: Demonstrates TMEM198's ability to facilitate phosphorylation. Typically combines purified substrates (e.g., MBP-tagged LRP6 intracellular domains), purified kinases (e.g., CK1ε), and GST-tagged TMEM198 cytoplasmic domains .

• Reporter assays: TOP/FOP luciferase reporters measure Wnt pathway activation in response to TMEM198 manipulation.

• Phosphorylation detection: Western blotting with phospho-specific antibodies assesses LRP6 phosphorylation status.

Cellular localization studies:

• Immunofluorescence: Determines subcellular localization of TMEM198 and co-localization with partners.

• Cell surface biotinylation: Confirms membrane localization and topology of TMEM198 .

What expression systems are optimal for producing recombinant TMEM198 for structural and functional studies?

Different expression systems offer distinct advantages for producing recombinant TMEM198:

Bacterial expression systems:

• Applications: Useful for producing isolated domains, particularly the cytoplasmic domain for interaction studies.

• Constructs: GST-TMEM198-C fusion proteins can be purified from E. coli .

• Limitations: Full-length transmembrane proteins often express poorly or form inclusion bodies.

Mammalian expression systems:

• Applications: Optimal for full-length TMEM198 with proper folding and post-translational modifications.

• Cell lines: HEK293T cells are commonly used for transient expression .

• Constructs: Addition of N-terminal signal peptides (e.g., from Kremen protein) can improve expression and membrane targeting .

Insect cell expression:

• Applications: Useful for larger-scale production of properly folded membrane proteins.

• Advantages: Baculovirus-infected insect cells can produce higher yields than mammalian systems while maintaining eukaryotic processing.

Cell-free systems:

• Applications: Rapid production for initial characterization.

• Advantages: Avoids cellular toxicity issues that may occur with overexpression.

Selection of the appropriate system depends on the specific experimental goals, whether structural characterization, functional assays, or antibody production.

How might TMEM198 function be therapeutically targeted in Wnt-dependent diseases?

Given TMEM198's role in Wnt signaling, several therapeutic approaches could be explored:

Potential therapeutic strategies:

• Small molecule inhibitors: Compounds targeting the interaction between TMEM198 and LRP6 or TMEM198 and casein kinases could modulate Wnt signaling in disease contexts.

• Peptide-based inhibitors: Designed peptides mimicking key interface regions could competitively inhibit TMEM198's scaffolding function.

• Antisense oligonucleotides or siRNA: Direct targeting of TMEM198 expression could downregulate Wnt signaling in conditions where pathway overactivation drives pathology.

• Monoclonal antibodies: For extracellular epitopes, antibodies could potentially disrupt TMEM198's interactions or induce its internalization.

Disease applications:

• Cancer: In contexts like osteosarcoma where TMEM198 is identified as a risk factor , inhibition might improve outcomes.

• Developmental disorders: Precision modulation of TMEM198 might address conditions resulting from Wnt pathway dysfunction.

• Degenerative diseases: Enhancement of TMEM198 function might benefit conditions where Wnt pathway stimulation is therapeutic.

What techniques can resolve contradictory data regarding TMEM198 function?

When facing conflicting results in TMEM198 research, several approaches can help resolve discrepancies:

Methodological approaches:

• Cell type and context specificity: Parallel experiments in multiple cell types can determine whether TMEM198 functions are context-dependent.

• Dosage sensitivity analysis: Titrating TMEM198 expression levels can reveal threshold effects or biphasic responses.

• Temporal dynamics studies: Time-course experiments can distinguish between primary and secondary effects of TMEM198 manipulation.

• Interaction partner profiling: Techniques like BioID or APEX2 proximity labeling can comprehensively map context-specific interaction networks.

• Genetic background considerations: Experiments in cells or organisms with defined genetic backgrounds can reveal modifying factors.

Technical validation:

• Use of multiple, independent siRNAs or shRNAs to confirm knockdown phenotypes

• Rescue experiments with expression constructs resistant to siRNA targeting

• Application of orthogonal techniques to verify key findings

How can advanced genomic and proteomic approaches enhance understanding of TMEM198's roles?

Cutting-edge technologies offer opportunities to deepen our understanding of TMEM198:

Genomic approaches:

• ChIP-seq following TMEM198 manipulation: Identify genome-wide transcriptional changes to map downstream effectors.

• CRISPR screens: Discover genetic interactors and modifiers of TMEM198 function.

• Single-cell RNA-seq: Characterize cell type-specific responses to TMEM198 modulation in complex tissues.

Proteomic approaches:

• Proximity labeling: BioID or APEX2 fusions with TMEM198 can identify proximal proteins in living cells.

• Phosphoproteomics: Global phosphorylation profiling following TMEM198 manipulation can reveal signaling networks beyond LRP6.

• Protein-protein interaction networks: Techniques like LUMIER (luminescence-based mammalian interactome mapping) can systematically map interactions.

Structural approaches:

• Cryo-electron microscopy: Could potentially resolve the structure of TMEM198 alone or in complex with partners like LRP6.

• Hydrogen-deuterium exchange mass spectrometry: Can map interaction interfaces without requiring full structural determination.

These advanced approaches could reveal TMEM198 functions beyond the currently established role in Wnt signaling, potentially uncovering novel therapeutic opportunities.

TMEM198 Sequence and Domain Information

Experimental Tools for TMEM198 Research

TMEM198 in Disease Context: Osteosarcoma Prognostic Signature Components