Recombinant Human Transmembrane protein 207 (TMEM207)

What is the biological function of TMEM207 in normal tissue?

TMEM207 (Transmembrane Protein 207) is a protein that functions in cellular stress response pathways, particularly those involving the endoplasmic reticulum (ER). In normal tissues, TMEM207 shows low or weak immunoreactivity in non-tumorous oral epithelial cells, suggesting limited expression under normal physiological conditions . The protein appears to be involved in protein folding regulation and cellular stress adaptation mechanisms. Research indicates that TMEM207 may play a role in ER stress response pathways, though its precise function in healthy tissues requires further investigation .

How is TMEM207 detected in experimental settings?

TMEM207 can be detected through several established laboratory techniques:

• Immunohistochemistry (IHC): Utilizing specific antibodies against TMEM207 after appropriate antigen retrieval methods (autoclaving for 15 min with 10 mM citrate, pH 6.0) . Samples are typically considered positive when more than 10% of tumor cells exhibit staining after examining five high-power fields in one tissue section .

• Immunofluorescence (IF/ICC): Recommended dilutions range from 1/50 to 1/200, optimized according to specific experimental conditions .

• Western Blotting: For protein expression analysis in cell lysates and tissue homogenates.

• ELISA: For quantitative determination of TMEM207 levels .

For optimal results, polyclonal antibodies derived from rabbit hosts have shown good reactivity against human TMEM207 .

What are the recommended controls when studying TMEM207 expression?

When designing experiments to study TMEM207 expression, researchers should implement the following controls:

• Negative Controls:

  • Tissues incubated with TMEM207 antibody pre-bound with the immunizing peptide to confirm specificity

  • Non-tumorous oral epithelial cells which typically show weak TMEM207 immunoreactivity

  • Empty vector-transfected cells in overexpression studies

• Positive Controls:

  • Known TMEM207-expressing oral squamous cell carcinoma (OSCC) tissues, particularly at the cancer invasion front

  • Cell lines with confirmed TMEM207 expression (such as SCC-9 or CHU-2)

• Technical Controls:

  • siRNA knockdown validation using at least two independent siRNA sequences (e.g., SI04341981 targeting AACACCCTAATGGCTGGTATA and SI04277770 targeting CACTAGTATCCAAACAGGCAA)

  • GFP-siRNA duplex non-silencing control for RNAi experiments

What is the relationship between TMEM207 and cancer development?

TMEM207 appears to play a significant role in cancer development, particularly in oral squamous cell carcinoma (OSCC). The protein impairs the tumor suppressor function of WW domain containing oxidoreductase (WWOX), which sensitizes cancer cells to ER stress-induced apoptosis .

Key findings regarding TMEM207 in cancer include:

• Increased Expression: TMEM207 shows significantly higher expression at the cancer invasion front compared to non-tumorous tissues .

• Prognostic Significance: Concomitant expression of TMEM207 with Cleft Lip and Palate Transmembrane 1-Like (Clptm1L) is significantly associated with poor outcome in OSCC patients (P = 0.00252) .

• Metastatic Potential: Co-expression of TMEM207 and Clptm1L is closely related to lymph node metastasis (P = 0.000574), suggesting a role in cancer dissemination .

• Xenograft Studies: Enforced expression of TMEM207 in SAS cells led to significantly larger tumors in xenoplant assays, despite showing no significant differences in in vitro proliferation compared to control cells .

How does TMEM207 interact with the WWOX tumor suppressor pathway?

TMEM207 exerts its oncogenic effects largely through interfering with the tumor suppressor function of WW domain containing oxidoreductase (WWOX). The molecular mechanism involves:

• Direct Interaction: TMEM207 appears to bind to WWOX, potentially through specific protein domains .

• Disruption of WWOX-HIF-1α Binding: Co-immunoprecipitation assays revealed that TMEM207-expressing SAS cells displayed decreased binding of WWOX to Hypoxia-Inducible Factor 1-alpha (HIF-1α) .

• HIF-1α Stabilization: TMEM207 expression leads to significant levels of HIF-1α even under normoxic conditions, while control cells show weak or no HIF-1α expression in the same conditions .

• Downstream Effects: The inhibition of WWOX-HIF-1α interaction may hamper the degradation of HIF-1α under normoxic conditions, potentially activating hypoxia-response genes inappropriately .

This mechanism suggests that TMEM207 functions as an oncogenic protein by specifically interfering with a key tumor suppressor pathway, highlighting its potential as a therapeutic target.

What methodologies are optimal for TMEM207 overexpression studies?

For researchers conducting TMEM207 overexpression studies, the following optimized methodological approach is recommended:

• Vector Construction:

  • Amplify the full coding sequence of human TMEM207 by PCR from kidney cDNAs

  • Subclone into an appropriate expression vector (pTarget vector has been successfully used)

  • Verify the construct by sequencing

• Transfection Protocol:

  • Seed cells at approximately 50% confluency in culture dishes

  • Replace culture medium with Opti-MEM prior to transfection

  • Use N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulphate (DOTAP) transfection reagents

  • Add 5 mg of BglII-linearized TMEM207 expression vector

  • Select colonies resistant to 600 μg/ml G418 after 3-4 weeks

  • Establish multiple independent clones (at least three) and confirm expression by Western blotting

• Controls:

  • Establish parallel cell lines transfected with empty vector as negative controls

  • Verify TMEM207 overexpression using both mRNA (RT-PCR) and protein (Western blot) analysis

• Functional Validation:

  • Perform both in vitro proliferation assays and in vivo xenograft studies to comprehensively assess the impact of TMEM207 overexpression

What are the methodological considerations for studying TMEM207 and Clptm1L co-expression in clinical samples?

When investigating the co-expression of TMEM207 and Clptm1L in clinical samples, researchers should consider these methodological aspects:

• Tissue Preparation:

  • Use surgically obtained tissue specimens fixed in 10% buffered formalin and embedded in paraffin

  • Exclude tissue specimens that underwent decalcification as this may affect antigen detection

  • Focus on the cancer invasion front, where expression of these markers appears most significant

• Immunohistochemical Staining:

  • For TMEM207: Perform antigen retrieval by autoclaving for 15 min with 10 mM citrate (pH 6.0)

  • For Clptm1L: Use appropriate antigen retrieval methods as specified in protocols

  • Consider double immunohistochemical staining to confirm co-localization (Clptm1L in brown, TMEM207 in red)

  • Define positive staining as more than 10% of tumor cells exhibiting immunoreactivity after examining five high-power fields

• Analysis Methods:

  • Use the Kaplan-Meier plot followed by log-rank test to analyze survival outcomes

  • Employ both univariate and multivariate Cox's regression analysis to determine independent prognostic value

  • Apply Fisher's exact test for comparing expression patterns with clinical pathological data

• Clinicopathological Correlation:

  • Carefully document patient parameters including age, gender, smoking history, tumor stage, and lymph node status

  • Assess relationship with specific features like lymph node metastasis (P=0.000574)

How can TMEM207 knockdown be effectively achieved in research settings?

For researchers seeking to investigate the effects of TMEM207 depletion, the following RNA interference approach has been validated:

• siRNA Selection:

  • Use multiple siRNAs targeting different regions of TMEM207 mRNA

  • Successful knockdown has been achieved with siRNAs SI04341981 (target sequence: AACACCCTAATGGCTGGTATA) and SI04277770 (target sequence: CACTAGTATCCAAACAGGCAA)

• Transfection Protocol:

  • Transfect siRNAs into target cells (such as SCC-9 or CHU-2) using Lipofectamine RNAiMAX according to manufacturer's instructions

  • Include a non-silencing control (e.g., GFP-siRNA duplex)

  • Harvest cells 48 hours post-transfection for subsequent studies

• Validation of Knockdown:

  • Confirm TMEM207 knockdown at both mRNA level (qRT-PCR) and protein level (Western blot)

  • Test multiple siRNAs to ensure specificity and reproduce findings with at least two independent sequences

• Functional Analysis:

  • Assess changes in cell proliferation, migration, invasion, and response to ER stress

  • Examine effects on WWOX binding to HIF-1α through co-immunoprecipitation assays

  • Evaluate GLUT-1 expression as a downstream marker of HIF-1α activity

What is the prognostic significance of TMEM207 expression in oral cancer?

TMEM207 expression has significant prognostic implications in oral squamous cell carcinoma (OSCC), particularly when co-expressed with Clptm1L:

• Survival Impact: Concomitant expression of Clptm1L and TMEM207 is significantly associated with poor outcome in OSCC patients (P = 0.00252) .

• Independent Prognostic Value: Both univariate and multivariate analyses demonstrate that co-expression of Clptm1L and TMEM207 predicts poor prognosis, with multivariate Cox's regression analysis confirming it as an independent worse prognostic factor (P = 0.032) .

• Correlation with Metastasis: Double positive Clptm1L and TMEM207 immunoreactivity is closely related to lymph node metastasis (P = 0.000574), providing a potential biomarker for metastatic potential .

• Histopathological Pattern: The expression is particularly significant at the cancer invasion front, suggesting a role in invasive behavior .

These findings indicate that TMEM207 expression analysis, especially in combination with Clptm1L, could serve as a valuable prognostic tool in clinical management of OSCC patients.

How does cigarette smoking influence TMEM207 expression in oral cancer?

Research has identified an intriguing relationship between smoking habits and TMEM207 expression in OSCC:

• Statistical Correlation: Clptm1L and TMEM207 expression are significantly related to smoking habits in OSCC patients .

• Mechanistic Hypothesis: Cigarette smoke induces ER stress in both normal and malignant tumor cells. Overexpression of TMEM207 may promote oral squamous cell carcinogenesis by conferring resistance to cigarette smoke-associated ER stress .

• Alternative Hypothesis: Cigarette smoking-associated ER stress might induce the expression of TMEM207 in OSCC cells as part of a stress response mechanism .

• Research Implications: The relationship between cigarette smoke and TMEM207/Clptm1L expression requires further investigation to establish causality and potential preventive or therapeutic interventions .

This connection highlights the importance of considering environmental factors when studying TMEM207 expression in clinical samples and suggests potential mechanisms linking smoking and oral carcinogenesis.

What are the molecular mechanisms linking TMEM207 to increased tumor growth and metastasis?

The molecular pathways through which TMEM207 contributes to tumor progression and metastasis involve several interconnected mechanisms:

• WWOX Inhibition Pathway:

  • TMEM207 binds to and inhibits WWOX tumor suppressor function

  • This leads to decreased binding between WWOX and HIF-1α

  • HIF-1α stabilization occurs even under normoxic conditions

  • Inappropriate activation of hypoxia-response genes follows

• GLUT-1 Upregulation:

  • Xenotransplanted TMEM207-expressing SAS cells show ubiquitous GLUT-1 expression

  • Control SAS cells show sparse GLUT-1 expression

  • Increased glucose uptake may support enhanced metabolic demands of aggressive cancer cells

• ER Stress Response Modulation:

  • TMEM207 appears to confer resistance to ER stress-induced apoptosis

  • This may allow cancer cells to survive under conditions that would normally trigger cell death

• Correlation with Nodal Metastasis:

  • GRP78 might be a key molecule associated with high lymph node metastasis rate in Clptm1L and TMEM207 co-expressed OSCC

  • Overexpression of GRP78 increases lymph node metastasis in various cancers

These mechanisms collectively contribute to enhanced tumor growth, survival under stress conditions, and increased metastatic potential, making TMEM207 a promising target for therapeutic intervention.

What are the optimal antibody selection criteria for TMEM207 detection?

When selecting antibodies for TMEM207 detection, researchers should consider these technical specifications:

• Antibody Characteristics:

  • Host: Rabbit polyclonal antibodies have shown good reactivity against human TMEM207

  • Target region: Antibodies targeting recombinant human TMEM207 protein (73-146AA) have been validated

  • Format: Unconjugated antibodies in liquid form with > 95% purity

• Application-Specific Dilutions:

  • IHC: 1/20 - 1/200

  • IF/ICC: 1/50 - 1/200

  • Optimal dilutions should be determined by end-user for specific experimental conditions

• Storage and Handling:

  • Aliquot and store at -20°C

  • Avoid repeated freeze/thaw cycles

  • Typical buffer composition: 0.01 M PBS, pH 7.4, 0.03% Proclin-300 and 50% Glycerol

• Validation Methods:

  • Confirm specificity by pre-incubating with immunizing peptide

  • Include appropriate positive and negative tissue controls

  • For xenograft studies, human-specific antibodies should be selected to avoid cross-reactivity with host tissues

How should researchers design experiments to investigate the relationship between TMEM207 and ER stress?

To effectively study the relationship between TMEM207 and endoplasmic reticulum (ER) stress, consider this experimental design framework:

• ER Stress Induction Models:

  • Chemical inducers: Tunicamycin, thapsigargin, or DTT at optimized concentrations

  • Physiological inducers: Glucose deprivation, hypoxia, or cigarette smoke extract

  • Genetic models: Overexpression of misfolded proteins or knockdown of ER chaperones

• TMEM207 Expression Manipulation:

  • Parallel experiments with TMEM207 overexpression and knockdown under ER stress conditions

  • Time-course analysis to determine temporal relationship between ER stress and TMEM207 expression

  • Co-expression studies with Clptm1L to assess potential synergistic effects

• Readouts and Analytical Methods:

  • ER stress markers: BiP/GRP78, CHOP, XBP1 splicing, ATF4 and ATF6 activation

  • Apoptosis markers: Cleaved caspase-3, PARP cleavage, Annexin V staining

  • Survival pathways: Phosphorylation status of key signaling molecules

  • Gene expression profiling using RNA-seq to identify broader transcriptional responses

• Mechanistic Validation:

  • Co-immunoprecipitation to identify TMEM207 interaction partners under ER stress

  • Chromatin immunoprecipitation to assess HIF-1α binding to target genes

  • Subcellular localization studies using confocal microscopy

  • Rescue experiments using WWOX overexpression in TMEM207-expressing cells

What approach should be taken to investigate potential therapeutic targeting of TMEM207?

For researchers exploring TMEM207 as a therapeutic target, the following comprehensive approach is recommended:

• Target Validation Strategy:

  • Determine tissue specificity of TMEM207 expression across normal vs. cancer tissues

  • Assess dependence of cancer cells on TMEM207 using genetic knockdown in multiple cell lines

  • Evaluate synthetic lethality by identifying cellular contexts where TMEM207 inhibition is selectively toxic

  • Confirm in vivo relevance using conditional knockout models or inducible shRNA systems

• Therapeutic Modality Selection:

  • Small molecule inhibitors targeting TMEM207-WWOX interaction

  • Antibody-based approaches if TMEM207 has accessible extracellular domains

  • siRNA/antisense oligonucleotides for expression knockdown

  • Proteolysis-targeting chimeras (PROTACs) for targeted protein degradation

• Combination Therapy Assessment:

  • Test with ER stress-inducing chemotherapeutics

  • Evaluate synergy with HIF-1α inhibitors

  • Explore combinations with immune checkpoint inhibitors

  • Investigate radiosensitization potential

• Predictive Biomarker Development:

  • Establish IHC protocols for patient stratification based on TMEM207/Clptm1L co-expression

  • Identify gene signatures that predict sensitivity to TMEM207 targeting

  • Develop liquid biopsy approaches to monitor treatment response

  • Create patient-derived xenograft models from tumors with varying TMEM207 expression

This strategic approach enables systematic evaluation of TMEM207 as a therapeutic target while addressing key questions of efficacy, specificity, and clinical translation.

What is the role of TMEM207 in cancer metabolic reprogramming?

Emerging evidence suggests TMEM207 may play a significant role in cancer metabolic reprogramming:

• GLUT-1 Regulation: Xenotransplanted TMEM207-expressing SAS cells show ubiquitous GLUT-1 expression compared to sparse expression in control cells, indicating a potential role in glucose metabolism regulation .

• HIF-1α Stabilization: TMEM207 disrupts WWOX-HIF-1α binding, leading to HIF-1α stabilization even under normoxic conditions . HIF-1α is a master regulator of metabolic reprogramming that promotes glycolysis over oxidative phosphorylation in cancer cells.

• Metabolic Stress Adaptation: The connection between TMEM207 and ER stress response pathways suggests it may help cancer cells adapt to metabolic stress conditions, potentially through regulation of protein folding and quality control systems .

• Research Opportunities: Future studies should investigate:

  • Metabolomic profiling of TMEM207-expressing versus control cells

  • Analysis of key metabolic enzymes regulated by HIF-1α in TMEM207-overexpressing cells

  • Glucose consumption and lactate production measurements

  • Mitochondrial function assessment in the context of TMEM207 expression

These connections suggest TMEM207 may contribute to the Warburg effect and other metabolic alterations characteristic of aggressive cancer phenotypes.

How might TMEM207 interact with the tumor microenvironment?

While direct evidence is limited, several research pathways suggest potential interactions between TMEM207 and the tumor microenvironment:

• Hypoxia Response: Through its effect on HIF-1α stabilization , TMEM207 may influence:

  • Angiogenesis via VEGF regulation

  • Extracellular matrix remodeling

  • Recruitment of immune-suppressive cells

• Invasion and Metastasis: The significant expression of TMEM207 at the cancer invasion front suggests it may mediate interactions with:

  • Stromal fibroblasts

  • Extracellular matrix components

  • Immune cells at the invasive margin

• Inflammatory Signaling: The correlation between TMEM207 and smoking-related carcinogenesis raises questions about potential roles in:

  • Inflammatory cytokine signaling

  • Oxidative stress responses

  • Recruitment of tumor-associated macrophages

• Experimental Approaches:

  • Co-culture systems with cancer-associated fibroblasts

  • 3D organoid models incorporating stromal components

  • Analysis of secreted factors from TMEM207-expressing cells

  • Immune profiling of TMEM207-high versus TMEM207-low tumors

This represents an important frontier for TMEM207 research with potential implications for understanding the full spectrum of its cancer-promoting activities.