Recombinant Human Transmembrane protein 223 (TMEM223)

What is TMEM223 and what is its cellular localization?

TMEM223 is a transmembrane protein that functions as a mitochondrial ribosome-associated factor involved in complex IV (cytochrome c oxidase) biogenesis. Subcellular localization studies involving hypo-osmotic swelling and carbonate extraction experiments have definitively shown that TMEM223 is an integral protein of the inner mitochondrial membrane (IMM) . Proteinase K treatment of mitoplasts results in a faster-migrating C-terminal fragment of TMEM223, indicating that its C-terminus is exposed to the mitochondrial matrix . Combined with its resistance to carbonate extraction, these findings confirm that TMEM223 is embedded in the IMM with both its N- and C-termini facing the mitochondrial matrix .

This topological arrangement is functionally significant as it positions TMEM223 ideally to interact with both the mitochondrial translation machinery and the nascent respiratory chain complex components. For researchers investigating TMEM223, establishing its precise submitochondrial localization through differential centrifugation followed by protease protection assays represents an essential initial characterization step.

What is the structural characterization of TMEM223?

TMEM223 displays two putative transmembrane spans but lacks a defined N-terminal mitochondrial targeting sequence . This structural arrangement is somewhat unusual for mitochondrial proteins, which typically contain N-terminal targeting sequences to direct their import into mitochondria. The absence of such a sequence suggests that TMEM223 may utilize an alternative import pathway or contains internal targeting information.

The protein's C-terminus contains epitopes recognizable by commercially available antibodies, making it accessible for detection in various experimental setups . Structural analysis methods should include:

• Hydropathy plot analysis to confirm the predicted transmembrane domains

• Protease protection assays to experimentally verify membrane topology

• Crosslinking studies to identify interaction interfaces with partner proteins

• Structural prediction algorithms to generate working models of the protein's conformation

When designing experiments to study TMEM223, researchers should consider its membrane-embedded nature, which may require specialized approaches for solubilization and purification while maintaining native structure and function.

How can TMEM223 knockout models be generated for functional studies?

Generating TMEM223 knockout models is a critical approach for understanding its function. Based on published methodologies, researchers can establish TMEM223 knockout cell lines using CRISPR/Cas9 genome editing . The protocol includes:

• Design of TMEM223-specific oligonucleotides (e.g., targeting sequence GCAAGGCACGACGCTGCAAC and its reverse complement)

• Cloning these oligonucleotides into a vector such as pX330

• Co-transfection with a fluorescent marker plasmid (e.g., pEGFP-N1) into target cells

• Single-cell sorting by flow cytometry 3 days post-transfection

• Screening of resulting colonies by immunoblotting and sequencing of the targeted gene region

Validation of knockout should include sequencing confirmation of genomic modifications (such as nucleotide exchanges resulting in premature stop codons) and western blot analysis demonstrating the absence of TMEM223 protein . For phenotypic characterization, researchers should examine parameters including:

• Steady-state levels of mitochondrial proteins, particularly complex IV components

• Assembly status of respiratory chain complexes using Blue Native PAGE

• Mitochondrial translation rates using [35S]methionine labeling

• Enzymatic activity of cytochrome c oxidase using colorimetric assays

Alternative approaches include siRNA-mediated depletion, which can be useful for studying acute effects of TMEM223 loss versus the potentially compensated phenotype in stable knockout lines .

What is the functional relationship between TMEM223 and cytochrome c oxidase assembly?

TMEM223 plays a specific role in the early stages of cytochrome c oxidase (complex IV) biogenesis. Experimental evidence demonstrates that TMEM223 knockout cells exhibit a selective reduction of cytochrome c oxidase to approximately 60% of wild-type levels, with a corresponding decrease in enzyme activity to 62.5% of control . This reduction is specifically linked to decreased synthesis of the mitochondrially-encoded COX1 subunit, while translation of other mitochondrial proteins, including the complex IV components COX2 and COX3, remains unaffected .

To investigate this relationship, researchers should employ the following methodological approaches:

• Mitochondrial translation analysis: Perform [35S]methionine labeling of mitochondrial translation products in control versus TMEM223-depleted cells, focusing on COX1 synthesis rates.

• Assembly intermediate analysis: Conduct immunoprecipitation experiments using tagged constituents of early COX1 assembly intermediates (MITRAC complexes), such as C12ORF62 (COX14), MITRAC12 (COA3), and CMC1, to determine the association of TMEM223 with these complexes .

• Blue Native PAGE analysis: Assess the assembly state of respiratory chain complexes using different detergents (DDM and digitonin) to solubilize mitochondrial membranes followed by BN-PAGE .

• Enzyme activity measurements: Perform colorimetric assays to quantitatively assess cytochrome c oxidase activity in control versus TMEM223-depleted cells .

The experimental evidence indicates that TMEM223 is predominantly found in early assembly MITRAC intermediates containing C12ORF62 (COX14) and MITRAC12 (COA3), but is released during later assembly stages, as indicated by its minimal association with later MITRAC complexes containing MITRAC7 . This suggests that TMEM223 functions specifically during initial COX1 assembly steps rather than throughout the entire complex IV assembly process.

How does TMEM223 interact with the mitochondrial ribosome?

TMEM223 has been identified as a mitochondrial ribosome-associated protein through comprehensive proteomic analysis . To investigate and characterize these interactions, researchers should consider the following approaches:

• Affinity purification-mass spectrometry: Perform immunoprecipitation of tagged mitochondrial ribosomal proteins followed by mass spectrometry to identify associated factors, including TMEM223.

• Co-immunoprecipitation validation: Conduct reciprocal co-immunoprecipitation experiments using antibodies against TMEM223 and mitochondrial ribosomal proteins to confirm direct interactions.

• Proximity labeling: Utilize BioID or APEX2-based proximity labeling approaches to identify proteins in close spatial proximity to TMEM223 within the mitochondrial translation machinery.

• Cryo-electron microscopy: For structural characterization of TMEM223-ribosome complexes, cryo-EM represents the gold standard approach to visualize interaction interfaces.

Experimental evidence confirms that TMEM223 associates with mitochondrial ribosomes, likely functioning at the interface between translation and assembly of newly synthesized mitochondrial proteins, particularly COX1 . This positioning allows TMEM223 to couple the translation of COX1 mRNA with the early assembly steps of cytochrome c oxidase, ensuring efficient integration of this critical subunit into the complex.

What methodologies are recommended for studying TMEM223's effect on COX1 translation?

To investigate TMEM223's role in COX1 mRNA translation, researchers should implement the following methodological approaches:

• Pulse labeling of mitochondrial translation products:

  • Perform [35S]methionine labeling in control versus TMEM223-depleted cells

  • Quantify the synthesis rates of individual mitochondrial-encoded proteins

  • Compare COX1 synthesis specifically between conditions

• Ribosome profiling:

  • Apply ribosome profiling techniques adapted for mitochondrial ribosomes

  • Analyze ribosome occupancy on COX1 mRNA in the presence/absence of TMEM223

  • Identify potential ribosome pausing sites that might be regulated by TMEM223

• RNA immunoprecipitation (RIP):

  • Perform immunoprecipitation of TMEM223 followed by RNA extraction

  • Analyze co-precipitated RNAs to determine if TMEM223 directly interacts with COX1 mRNA

  • Validate findings using in vitro binding assays

• Complementation studies:

  • Reintroduce wild-type TMEM223 or mutant variants into knockout cells

  • Assess rescue of COX1 translation defects to identify functional domains

  • Create chimeric proteins to determine specificity for COX1 translation

The experimental evidence demonstrates that TMEM223 knockout cells display a significant and specific decrease in newly synthesized COX1 levels compared to wild-type cells, while other mitochondrial-encoded proteins, including COX2 and COX3, remain unaffected . Similar results were observed in siRNA-mediated TMEM223-depleted cells, confirming the specific effect on COX1 synthesis .

How is the compensatory increase in complex III related to TMEM223 deficiency?

An intriguing observation in TMEM223 knockout cells is the compensatory increase in complex III (cytochrome c reductase) levels, reaching approximately 165% of wild-type levels . This appears to be a stress response mechanism to compensate for reduced cytochrome c oxidase activity. To investigate this phenomenon, researchers should consider the following approaches:

• Time-course analysis:

  • Examine the temporal relationship between complex IV reduction and complex III increase

  • Determine whether complex III upregulation is an immediate or delayed response

• Protein stability assessment:

  • Analyze the stability of complex III components (e.g., RIESKE, UQCC1, UQCC2) after inhibition of mitochondrial translation

  • Compare stability between wild-type and TMEM223 knockout cells

• Transcriptional regulation analysis:

  • Perform qRT-PCR to measure mRNA levels of nuclear-encoded complex III components

  • Identify potential transcription factors activated in response to TMEM223 deficiency

• Retrograde signaling investigation:

  • Examine activation of mitochondrial stress response pathways

  • Analyze Ca2+ signaling, ROS production, and other potential retrograde signals

Experimental data shows that while complex III levels increase in TMEM223 knockout cells, the stability of tested proteins including RIESKE, UQCC1, and C12ORF73 does not differ between wild-type and knockout conditions . This suggests that the increase in complex III might result from enhanced synthesis or assembly rather than altered protein turnover.

How can researchers distinguish between direct and indirect effects of TMEM223 on cytochrome c oxidase biogenesis?

Distinguishing between direct and indirect effects of TMEM223 on cytochrome c oxidase biogenesis represents a significant challenge. To address this, researchers should implement the following methodological approaches:

• Acute versus chronic depletion comparison:

  • Compare phenotypes between inducible short-term depletion and stable knockout models

  • Identify immediate effects (likely direct) versus adaptative responses (potentially indirect)

• Structure-function analysis:

  • Generate point mutations in TMEM223 that disrupt specific interactions

  • Assess which aspects of the TMEM223 knockout phenotype can be attributed to particular domains

• Temporal analysis of complex assembly:

  • Perform pulse-chase labeling of mitochondrial translation products

  • Track the kinetics of labeled COX1 incorporation into assembly intermediates and mature complexes

• In vitro reconstitution:

  • Develop reconstituted systems with purified components to test direct biochemical activities

  • Assess whether TMEM223 directly influences translation efficiency or nascent chain handling

What are the optimal cell culture conditions for studying TMEM223 function?

When investigating TMEM223 function, researchers should carefully consider cell culture conditions, as these can significantly impact mitochondrial phenotypes. Based on published methodologies, the following approaches are recommended:

• Media composition:

  • Culture cells in high glucose (4.5 mg/ml) DMEM for standard conditions

  • Alternatively, use galactose (0.9 mg/ml) DMEM to force reliance on oxidative phosphorylation

  • Supplement media with 10% FBS, 1 mM sodium pyruvate, 2 mM L-glutamine, and 50 μg/ml uridine

• Growth conditions:

  • Maintain cells at 37°C under a 5% CO2 humidified atmosphere

  • Regularly monitor cell growth rates using a Neubauer counting chamber

• Metabolic manipulation:

  • For inhibition of cytosolic translation, supplement DMEM with 100 μg/ml emetine dihydrochloride hydrate

  • For inhibition of mitochondrial translation, use thiamphenicol treatment

• Quality control:

  • Regularly test cell lines for mycoplasma contamination

  • Monitor passage number to avoid senescence-related effects

For specialized experiments such as stable isotope labeling with amino acids in cell culture (SILAC) analysis, follow established protocols as previously described in the literature . When comparing wild-type and TMEM223 knockout cells, maintain identical culture conditions to ensure that observed phenotypic differences can be attributed to TMEM223 deficiency rather than culture variables.

What techniques are recommended for analyzing TMEM223 interactions with assembly factors?

To characterize TMEM223 interactions with cytochrome c oxidase assembly factors, researchers should employ the following techniques:

• Co-immunoprecipitation (co-IP):

  • Generate cell lines expressing FLAG-tagged constituents of early COX1 assembly intermediates

  • Perform immunoprecipitation using anti-FLAG antibodies

  • Analyze co-precipitated proteins by western blotting, focusing on TMEM223

• Proximity-based interaction mapping:

  • Utilize BioID or APEX2 fusion proteins to identify proteins in close proximity to TMEM223

  • Analyze biotinylated proteins by mass spectrometry for comprehensive interaction profiling

• Blue Native PAGE analysis:

  • Solubilize mitochondria using appropriate detergents (DDM or digitonin)

  • Separate native protein complexes by BN-PAGE

  • Perform second-dimension SDS-PAGE for detailed composition analysis

• Crosslinking mass spectrometry:

  • Apply protein crosslinking to stabilize transient interactions

  • Identify crosslinked peptides by mass spectrometry to map interaction interfaces

Experimental evidence has demonstrated that TMEM223 is recovered in immunoprecipitations of C12ORF62 (COX14) and MITRAC12 (COA3), but not in precipitations of CMC1, with only marginal amounts detected in MITRAC7 immunoprecipitations . This selective interaction pattern supports TMEM223's role in the earliest steps of cytochrome c oxidase biogenesis, specifically in association with MITRAC complexes that mediate the initial assembly of COX1.

How should researchers design experiments to study the overlapping functions of assembly factors?

The experimental evidence suggests that TMEM223 may have partially overlapping functions with other assembly factors such as C12ORF62 (COX14) or MITRAC12 (COA3) . To investigate functional redundancy and cooperation between these factors, researchers should implement the following experimental approaches:

• Double knockout/knockdown studies:

  • Generate single and double knockouts of TMEM223 and other early assembly factors

  • Compare phenotypic severity to assess functional redundancy

  • Analyze whether combined depletion produces synergistic or additive effects

• Rescue experiments:

  • Overexpress one assembly factor in cells depleted of another

  • Determine whether functional complementation occurs

  • Identify domains required for cross-complementation

• Domain swap experiments:

  • Create chimeric proteins between TMEM223 and other assembly factors

  • Test whether specific domains are functionally equivalent

  • Map the regions responsible for unique versus shared functions

• Temporal analysis of assembly factor recruitment:

  • Use inducible expression systems to control the timing of assembly factor availability

  • Determine the sequence of assembly factor recruitment to nascent COX1

  • Assess whether recruitment patterns change in the absence of particular factors

What are promising approaches for developing recombinant TMEM223 for structural studies?

Structural characterization of TMEM223 would significantly advance our understanding of its function. Researchers interested in producing recombinant TMEM223 for structural studies should consider the following strategies:

• Expression system selection:

  • Evaluate prokaryotic (E. coli) versus eukaryotic (insect cells, mammalian cells) expression systems

  • Consider cell-free expression systems for potentially toxic membrane proteins

  • Test expression of full-length protein versus soluble domains

• Construct design:

  • Include affinity tags (His, FLAG) for purification

  • Consider fusion partners to enhance solubility

  • Design constructs with native versus optimized codon usage

• Purification strategy:

  • Select appropriate detergents for membrane protein extraction

  • Implement multi-step purification protocols (affinity, ion exchange, size exclusion)

  • Optimize buffer conditions to maintain protein stability

• Structural analysis methods:

  • X-ray crystallography for high-resolution structure determination of soluble domains

  • Cryo-electron microscopy for full-length protein or protein-ribosome complexes

  • NMR spectroscopy for dynamic regions and ligand binding studies

While no published structure of TMEM223 currently exists, researchers can draw upon successful approaches used for other inner mitochondrial membrane proteins. The presence of two transmembrane domains and matrix-exposed termini should be considered when designing expression constructs and purification strategies.

How might systems biology approaches advance our understanding of TMEM223's role in mitochondrial function?

Systems biology approaches offer powerful tools for understanding TMEM223's role within the broader context of mitochondrial function. Researchers should consider the following methodologies:

• Multi-omics integration:

  • Combine proteomics, transcriptomics, and metabolomics data from TMEM223 knockout models

  • Identify network-level changes beyond direct interactors

  • Map metabolic adaptations to TMEM223 deficiency

• Mathematical modeling:

  • Develop kinetic models of cytochrome c oxidase assembly

  • Incorporate TMEM223's role in COX1 translation and early assembly

  • Simulate the effects of TMEM223 depletion on respiratory chain function

• Evolutionary analysis:

  • Compare TMEM223 conservation across species

  • Identify co-evolving proteins as potential functional partners

  • Assess whether TMEM223's role is conserved in model organisms

• Phenotypic profiling:

  • Perform comprehensive phenotypic characterization under various stress conditions

  • Identify genetic interactions through synthetic lethality screens

  • Map TMEM223 to specific cellular pathways based on phenotypic signatures

The observed increase in complex III levels in TMEM223 knockout cells highlights the importance of systems-level analysis, as it reveals compensatory mechanisms that might not be apparent from studying isolated complexes. Understanding these adaptive responses will provide valuable insights into mitochondrial homeostasis and respiratory chain assembly regulation.