Recombinant Human Zinc transporter 9 (SLC30A9)

What is SLC30A9 and what is its cellular localization?

SLC30A9 (ZnT9) is a member of the solute carrier 30 (SLC30) family of zinc transporters. Unlike other family members, SLC30A9 primarily localizes to mitochondria in both invertebrate and vertebrate cells. This mitochondrial localization has been experimentally confirmed through colocalization studies using mitochondria-targeted markers (e.g., mito-mKate) in HeLa cells, where human SLC30A9-GFP fusion proteins show near-perfect overlap with mitochondrial markers . While the majority of SLC30A9 localizes to mitochondria, some minor non-mitochondrial localization has also been observed, although this represents a small fraction of the total cellular SLC30A9 .

How does SLC30A9 function in zinc transport within cells?

SLC30A9 functions as a zinc exporter, specifically transporting zinc from the mitochondrial matrix to the cytosol. Multiple lines of evidence support this function:

• Sequence homology with established zinc transporters, including structural similarity to the bacterial Zn²⁺/H⁺ exchanger YiiP

• Increased mitochondrial zinc levels in SLC30A9 knockout cells, as measured by zinc-specific fluorescent indicators like Zinpyr-1

• Requirement of putative Zn²⁺/H⁺ binding sites for proper function, demonstrated through mutagenesis experiments

The transporter likely utilizes the mitochondrial proton gradient generated by the electron transport chain to drive zinc export, functioning as a Zn²⁺/H⁺ exchanger . This mechanism is critical for maintaining appropriate zinc concentrations within mitochondria, which is essential for proper mitochondrial function and morphology.

What experimental approaches can researchers use to verify SLC30A9 localization?

Researchers can employ several complementary approaches to verify SLC30A9's mitochondrial localization:

• Fluorescent protein fusion: Express SLC30A9 fused to GFP or other fluorescent proteins and co-express with mitochondrial markers (e.g., mito-mKate) to assess colocalization using confocal microscopy

• Immunofluorescence: Use specific antibodies against endogenous SLC30A9 combined with mitochondrial staining to verify native protein localization

• Subcellular fractionation: Isolate mitochondrial fractions from cells and detect SLC30A9 by Western blotting, comparing with markers for other organelles to confirm specificity

• Super-resolution microscopy: For more precise localization within mitochondrial compartments (outer membrane, inner membrane, or matrix)

• Electron microscopy with immunogold labeling: For ultrastructural localization at the highest resolution

These approaches should be used in combination to provide robust evidence for SLC30A9's mitochondrial localization and to determine its specific submitochondrial localization .

How can researchers generate and validate SLC30A9 knockout cell lines?

Researchers can generate SLC30A9 knockout cell lines using CRISPR-Cas9 genome editing. The following methodology has been successfully employed:

• sgRNA design: Select guide RNA sequences targeting exonic regions of SLC30A9. For example, the sgRNA sequence 5′‐CCCTGTAGTCATCCATATATTGG‐3′ targeting exon 2 has been effective

• Delivery system: Use AAV-U6-sgRNA-CMV-mCherry vector expressing the sgRNA in cells stably expressing Cas9 protein

• Single cell isolation: Sort mCherry-positive cells using FACS to establish single-cell-derived clones

• Validation methods:

  • PCR and sequencing to confirm gene editing (primers: forward 5′-AAAATCGGTGACAGT-ATGAATGAAT-3′, reverse 5′-TAATAAAACACAAACCTCTGGGAAG-3′)

  • qPCR to verify reduced mRNA expression

  • Western blotting to confirm protein absence

  • Immunofluorescence to visually confirm protein loss

• Phenotypic validation: Assess predicted phenotypes such as mitochondrial zinc accumulation using Zinpyr-1 staining and mitochondrial morphology changes

What are the consequences of SLC30A9 dysfunction on mitochondrial morphology and function?

SLC30A9 deficiency leads to profound changes in mitochondrial morphology and function:

These findings demonstrate that SLC30A9 is essential for maintaining mitochondrial function through zinc homeostasis, affecting multiple aspects of mitochondrial biology including respiratory chain function, redox balance, and structural integrity .

How can researchers measure zinc levels in mitochondria of SLC30A9 knockout cells?

To quantify mitochondrial zinc levels in SLC30A9 knockout cells, researchers can employ:

• Fluorescent zinc indicators:

  • Zinpyr-1: A membrane-permeable fluorescent zinc indicator that can be used to assess zinc levels in living cells

  • Procedure: Incubate cells with Zinpyr-1 (typically 5-10 μM) for 30 minutes, co-stain with MitoTracker for mitochondrial identification, then image using confocal microscopy

  • Analysis: Quantify fluorescence intensity specifically in mitochondrial regions to determine relative zinc levels

• Mitochondria-targeted genetically encoded zinc sensors:

  • Express mitochondria-targeted zinc sensors (e.g., mito-ZapCY1) in cells

  • Measure FRET efficiency or fluorescence ratios to determine zinc concentrations

  • This approach allows for more precise subcellular targeting and potentially real-time measurements

• Control experiments:

  • Zinc chelator controls: Treat cells with membrane-permeable zinc chelators like TPEN (N,N,N′,N′-tetrakis[2-pyridylmethyl]ethylenediamine) to confirm zinc-specific signals

  • Compare zinc levels in other organelles (e.g., ER, nucleus) using compartment-specific indicators to verify specificity of mitochondrial zinc accumulation

• Advanced approaches:

  • ICP-MS analysis of isolated mitochondrial fractions for absolute quantification

  • Synchrotron X-ray fluorescence microscopy for high-resolution zinc mapping

These techniques provide complementary approaches to confirm zinc accumulation in mitochondria of SLC30A9-deficient cells .

What is the relationship between SLC30A9 and mitochondrial oxidative phosphorylation?

SLC30A9 plays a critical role in maintaining functional oxidative phosphorylation. The relationship includes:

• Direct impact on respiratory complexes:

  • SLC30A9 knockout cells show reduced levels of Complex I (NDUFB8) and Complex III (UQCRC2) subunits

  • Complex I activity is significantly reduced in SLC30A9-deficient cells

• Metabolic consequences:

  • ATP-linked oxygen consumption is significantly decreased in SLC30A9 knockout cells

  • Maximal respiration capacity (measured after FCCP treatment) is reduced

  • NADH/NAD⁺ ratio is lower in SLC30A9-deficient cells, consistent with reduced oxidative phosphorylation

• Potential mechanisms:

  • Zinc overload may directly inhibit respiratory complex activity

  • Mitochondrial structural abnormalities (swelling, loss of cristae) may disrupt the organization of respiratory complexes

  • Altered zinc homeostasis may affect the synthesis, import, or assembly of respiratory chain components

• Evolutionary evidence:

  • Evolutionary rate covariation analysis shows that SLC30A9 coevolves with several components of the mitochondrial oxidative phosphorylation chain, particularly complex I and the mitochondrial H⁺-driven ATP synthase (complex V)

These findings suggest that SLC30A9-mediated zinc export from mitochondria is essential for maintaining proper respiratory chain function and energy production .

How does SLC30A9 deficiency affect cellular redox state?

SLC30A9 deficiency leads to significant alterations in cellular redox balance:

• Abnormally reductive environment:

  • SLC30A9 knockout cells show a significantly increased GSH/GSSG ratio, indicating a more reductive environment in mitochondria

  • This has been confirmed using both the mitochondria-targeted Grx1-roGFP2 redox sensor and direct biochemical assays of isolated mitochondria

• Relationship to metabolic defects:

  • The reductive shift correlates with reduced oxidative phosphorylation activity

  • Normally, upregulation of mitochondrial ETC complexes and OXPHOS causes a low GSH/GSSG ratio, but the reverse occurs in SLC30A9-deficient cells

• Experimental approaches to measure redox changes:

  • Mitochondria-targeted Grx1-roGFP2: A genetically encoded fluorescent sensor that measures the GSH/GSSG ratio through changes in fluorescence properties

  • Direct biochemical measurement of GSH/GSSG ratio in isolated mitochondria using commercially available assay kits

  • Controls include treatment with reducing agents (dithiothreitol) or oxidizing agents (diamide) to confirm sensor function

• Potential consequences:

  • Altered redox signaling may affect multiple cellular processes

  • Reduced capacity to handle oxidative stress

  • Impaired activity of redox-sensitive enzymes and pathways

These findings indicate that SLC30A9's role in zinc homeostasis significantly impacts mitochondrial redox balance, with important implications for cellular metabolism and stress responses .

What experimental approaches can be used to investigate the role of SLC30A9 in neurological disorders?

Given the association of SLC30A9 mutations with cerebrorenal syndrome, several experimental approaches can investigate its role in neurological disorders:

• Patient-derived cellular models:

  • Generate induced pluripotent stem cells (iPSCs) from patients with SLC30A9 mutations

  • Differentiate iPSCs into neurons and glial cells

  • Analyze mitochondrial morphology, function, and zinc handling in disease-relevant cell types

• Animal models:

  • C. elegans models have already provided valuable insights into neuronal effects of SLC30A9 deficiency

  • Conditional knockout mice targeting SLC30A9 in specific neuronal populations

  • Behavioral testing to assess motor function and cognitive abilities

• Cellular mechanisms to investigate:

  • Mitochondrial transport in neurons: Examine if SLC30A9 deficiency affects mitochondrial distribution in axons and dendrites

  • Dendritic degeneration: Investigate whether SLC30A9 deficiency leads to progressive dendritic degeneration after normal development, mirroring the regression seen in patients

  • Synapse formation and function: Assess impact on synaptic transmission and plasticity

• Rescue experiments:

  • Test if wild-type SLC30A9 expression can rescue neural phenotypes

  • Examine if zinc chelation can ameliorate neuronal defects

  • Investigate if bypassing mitochondrial dysfunction through alternative energy substrates can improve neuronal function

• Molecular pathways:

  • RNA-seq to identify dysregulated pathways in SLC30A9-deficient neurons

  • Proteomics to assess changes in protein expression and post-translational modifications

  • Investigation of calcium signaling, which can be affected by abnormal zinc homeostasis

These approaches can help elucidate how SLC30A9 dysfunction contributes to neurological symptoms in cerebrorenal syndrome and potentially other neurological disorders .

How can the evolutionary conservation of SLC30A9 inform functional studies?

The unique evolutionary profile of SLC30A9 provides valuable insights for functional studies:

• Distinctive evolutionary trajectory:

  • SLC30A9 is deeply conserved from mammals through archaea and proteobacteria

  • Other SLC30A family members likely resulted from more recent gene duplication events

  • This suggests SLC30A9 may have a fundamental cellular function distinct from other family members

• Experimental applications of evolutionary conservation:

  • Model organism selection: The deep conservation allows meaningful studies in diverse model systems including bacteria, yeast, C. elegans, and mammalian cells

  • Comparative functional studies: Examining SLC30A9 function across evolutionary distance can reveal core conserved mechanisms

  • Structure-function analysis: Identifying conserved residues across species can pinpoint functionally critical domains

• Evolutionary rate covariation (ERC) approach:

  • ERC analysis reveals that SLC30A9 coevolves with components of the mitochondrial oxidative phosphorylation chain

  • This computational approach can predict functional relationships by identifying proteins that have experienced correlated rates of amino acid sequence evolution

  • Researchers can use ERC to generate hypotheses about SLC30A9's interaction partners and cellular pathways

• Methodological considerations:

  • Sequence alignment tools to identify conserved domains across species

  • Phylogenetic analysis to trace the evolutionary history of SLC30A9

  • Functional complementation studies to test if SLC30A9 from different species can rescue defects in knockout models

This evolutionary perspective provides a valuable framework for understanding SLC30A9's fundamental role in cellular function and designing experiments that focus on its most conserved and likely essential activities .

What is the role of SLC30A9 in cancer development and progression?

The relationship between SLC30A9 and cancer presents an emerging area of research:

• Altered expression in cancer:

  • SLC30A9 is significantly upregulated in gastric cancer tissues compared to non-cancerous tissues

  • Other SLC30A family members (SLC30A1-3, 5-7) also show increased expression in gastric cancer

• Potential mechanisms in cancer biology:

  • Mitochondrial dysfunction: Since SLC30A9 regulates mitochondrial function, its dysregulation may contribute to the metabolic reprogramming characteristic of cancer cells

  • Zinc homeostasis: Altered zinc distribution may affect tumor cell proliferation, apoptosis, and migration

  • Redox balance: Changes in mitochondrial redox state due to SLC30A9 dysregulation may influence cancer cell survival under stress conditions

• Experimental approaches to investigate SLC30A9 in cancer:

  • Expression analysis in tumor vs. normal tissues across multiple cancer types

  • Correlation of expression levels with clinical outcomes and cancer progression

  • Gain and loss of function studies in cancer cell lines to assess effects on:

    • Proliferation and cell cycle progression

    • Migration and invasion capabilities

    • Response to chemotherapy and radiation

    • Metabolic profiles

• Translational potential:

  • Prognostic biomarker development based on SLC30A9 expression patterns

  • Therapeutic targeting of zinc transport mechanisms in cancer cells

Further research is needed to fully elucidate the functional significance of SLC30A9 upregulation in cancer and its potential as a therapeutic target .

How can researchers assess whether mutations in SLC30A9 affect its zinc transport function?

To determine if SLC30A9 mutations impact zinc transport function, researchers can employ several complementary approaches:

• Structure-based mutational analysis:

  • Use sequence homology with known zinc transporters (YiiP, ZnT2, ZnT8) to predict zinc-binding sites

  • Create point mutations in key residues (e.g., D323A and H198A mutations in putative Zn²⁺/H⁺ binding sites)

  • Express mutant proteins and assess their ability to rescue phenotypes in SLC30A9-deficient cells

• Cellular zinc measurement approaches:

  • Express wild-type or mutant SLC30A9 in knockout cells and measure mitochondrial zinc levels using Zinpyr-1 or other zinc indicators

  • Perform zinc overload experiments (e.g., treating cells with elevated extracellular zinc) and measure mitochondrial zinc accumulation over time

  • Assess zinc clearance rates from mitochondria after zinc overload

• Functional transport assays:

  • Reconstitute purified wild-type or mutant SLC30A9 protein in liposomes with a pH gradient

  • Measure zinc transport using radioactive ⁶⁵Zn or fluorescent zinc indicators

  • Compare transport kinetics between wild-type and mutant proteins

• In vivo models:

  • Generate knock-in animals expressing SLC30A9 mutations

  • Assess tissue-specific zinc distribution and mitochondrial function

  • Correlate functional deficits with zinc transport abnormalities

• Patient-derived cells:

  • Analyze mitochondrial zinc handling in cells from patients with SLC30A9 mutations

  • Test rescue with wild-type SLC30A9 expression

These approaches can determine whether specific mutations affect zinc binding, transport activity, protein stability, or subcellular localization, providing insights into structure-function relationships and disease mechanisms .

What model systems are most appropriate for studying SLC30A9 function?

Multiple model systems offer complementary advantages for investigating SLC30A9 function:

• Cell culture models:

  • HeLa cells: Successfully used for CRISPR-Cas9 knockout and localization studies

  • Neuronal cell lines: Relevant for studying cerebrorenal syndrome mechanisms

  • Primary cells: Provide physiologically relevant context for tissue-specific effects

  • Advantages: Ease of genetic manipulation, accessible for imaging and biochemical analysis

• C. elegans:

  • Successfully used to study slc-30a9 function in multiple tissues including neurons and sperm

  • Allows examination of whole-organism phenotypes

  • Transparent body facilitates in vivo imaging of zinc dynamics

  • Advantages: Short lifecycle, genetic tractability, simple nervous system

• Vertebrate models:

  • Zebrafish: Transparent embryos facilitate visualization of zinc dynamics in developing tissues

  • Mice: Provide mammalian context for studying tissue-specific roles and disease models

  • Advantages: Physiological relevance to human disease, complex organ systems

• In vitro reconstitution systems:

  • Purified protein in liposomes for direct transport studies

  • Isolated mitochondria for functional assays

  • Advantages: Controlled environment for biochemical characterization

• Selection criteria based on research questions:

  • Evolutionary studies: Compare function across multiple species given SLC30A9's deep conservation

  • Disease mechanisms: Human cells or mammalian models

  • Basic transport mechanisms: In vitro systems or simple organisms

  • Developmental roles: Zebrafish or C. elegans

Each model system presents unique advantages for specific aspects of SLC30A9 biology, and complementary use of multiple models can provide the most comprehensive understanding .

How can researchers determine if SLC30A9 interacts with other mitochondrial proteins?

To identify and characterize SLC30A9 interactions with other mitochondrial proteins, researchers can employ multiple complementary approaches:

• Affinity purification-mass spectrometry (AP-MS):

  • Express tagged SLC30A9 (e.g., FLAG, HA, or BioID) in cells

  • Isolate mitochondria to enrich for relevant interactions

  • Perform immunoprecipitation followed by mass spectrometry

  • Compare results to appropriate controls (e.g., tag-only, unrelated mitochondrial protein)

• Proximity labeling approaches:

  • Express SLC30A9 fused to BioID or APEX2 in cells

  • These enzymes biotinylate nearby proteins when activated

  • Isolate biotinylated proteins and identify by mass spectrometry

  • Advantages: Can capture transient interactions and provides spatial context

• Co-immunoprecipitation validation:

  • Test specific interactions identified by high-throughput methods

  • Use antibodies against endogenous proteins when possible

  • Include appropriate controls (e.g., IgG control, reverse IP)

• Microscopy-based approaches:

  • Fluorescence resonance energy transfer (FRET) between SLC30A9 and candidate interactors

  • Proximity ligation assay (PLA) to visualize protein interactions in situ

  • Co-localization studies with super-resolution microscopy

• Functional validation:

  • Test if knockdown of interaction partners affects SLC30A9 localization or function

  • Assess mitochondrial zinc levels and morphology when disrupting specific interactions

  • Examine if interactions are modulated by zinc levels or mitochondrial status

• Computational predictions:

  • Leverage evolutionary rate covariation (ERC) analysis to predict functional relationships

  • SLC30A9 shows strong ERC signals with components of the mitochondrial oxidative phosphorylation chain

  • Use these predictions to prioritize candidates for experimental validation

These approaches will help identify SLC30A9's interaction network and provide insights into how it functions within the broader context of mitochondrial biology .

What techniques can be used to measure the kinetics of zinc transport by SLC30A9?

To characterize the kinetic properties of SLC30A9-mediated zinc transport, researchers can employ several specialized techniques:

• Real-time fluorescent zinc sensors in live cells:

  • Express genetically encoded zinc sensors targeted to mitochondria (e.g., mito-ZapCY1)

  • Create an experimental system for controlled zinc influx into cells

  • Monitor the rate of mitochondrial zinc clearance in cells with and without SLC30A9

  • Vary extracellular zinc concentrations to determine concentration-dependent kinetics

• Isolated mitochondria assays:

  • Prepare mitochondria from control and SLC30A9-deficient cells

  • Load mitochondria with zinc using ionophores or permeable zinc compounds

  • Measure zinc efflux rates using fluorescent indicators or radioactive ⁶⁵Zn

  • Test dependence on membrane potential by using protonophores (e.g., FCCP)

• Reconstituted proteoliposome systems:

  • Purify recombinant SLC30A9 protein and incorporate into liposomes

  • Create a pH gradient across the liposome membrane to mimic mitochondrial conditions

  • Measure zinc transport using stopped-flow fluorescence techniques with zinc-sensitive dyes

  • Determine Km, Vmax, and transport stoichiometry (Zn²⁺/H⁺ exchange ratio)

• Patch-clamp electrophysiology:

  • For measuring transport activity if SLC30A9 functions as an electrogenic transporter

  • Can be applied to mitoplasts (mitochondria with outer membrane removed)

  • Allows precise control of membrane potential and ion concentrations

• Analysis parameters to determine:

  • Transport rate as a function of zinc concentration

  • pH dependence of transport activity

  • Membrane potential dependence

  • Inhibitor sensitivity

  • Effects of mutations in putative binding sites (e.g., D323A, H198A)

These techniques will provide a comprehensive characterization of SLC30A9's transport properties, informing our understanding of how it maintains mitochondrial zinc homeostasis under various physiological conditions .