Recombinant Lactobacillus plantarum LexA repressor (lexA)

Basic Research Questions

• What is the LexA repressor in Lactobacillus plantarum and what is its primary function?

  The LexA repressor in L. plantarum is a transcriptional repressor that inhibits the expression of genes belonging to the SOS regulon, which are related to DNA repair and cell division. It functions by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA) in the promoter regions of target genes. The LexA protein is a critical component of the bacterial SOS response system that regulates cellular responses to DNA damage .

  LexA contains two primary functional domains:

  • A DNA-binding domain (typically located at the N-terminus)

  • A dimerization domain that enables formation of functional LexA dimers

  Under normal conditions, LexA dimers bind to SOS box sequences, preventing transcription of the genes in the SOS regulon. Upon DNA damage, LexA undergoes RecA-mediated autoproteolysis, cleaving into two fragments and losing its repressor function, thereby allowing expression of SOS response genes .

• How does the SOS response system function in L. plantarum?

  The SOS response in L. plantarum follows a regulatory mechanism similar to other bacteria but with species-specific components:

  1. DNA damage leads to accumulation of single-stranded DNA (ssDNA) in cells

  2. RecA protein binds to this ssDNA and becomes activated

  3. Activated RecA promotes LexA's self-protease activity

  4. LexA undergoes autoproteolysis, splitting into two fragments

  5. Cleaved LexA loses its repressor function

  6. SOS regulon genes are derepressed and expressed

  7. DNA repair mechanisms and mutagenic activities are enhanced

  The SOS regulon in L. plantarum includes genes encoding DNA repair enzymes, error-prone DNA polymerases, and cell division inhibitors. Key genes in this network include recA, lexA itself, umuC, and dinP, which show highly correlated expression patterns (correlation coefficients: recA-umuC: 0.82; recA-lexA: 0.75; recA-dinP: 0.88) .

• What methods can be used to express recombinant LexA in L. plantarum?

  Several expression systems can be used to produce recombinant LexA in L. plantarum:

  1. Inducible promoter systems:

     • PlacA: An endogenous promoter/repressor system inducible by lactose

     • PxylA: A system derived from Bacillus megaterium, inducible by xylose

     • PlacSynth: A synthetic promoter based on E. coli lac operon, inducible by TMG and IPTG

  2. Phage-derived promoter/repressor systems:

     • Recently discovered phage-derived systems show high expression levels in L. plantarum WCFS1

  3. CRISPR/Cas9-assisted recombineering:

     • Can be used for precise genome editing and gene insertion in L. plantarum

  4. Sakacin P expression system (pSIP):

     • An inducible system controlled by SppIP inducer at concentrations around 50 ng/mL

  Optimal expression conditions typically involve induction at 37°C for 6-10 hours, with protein yields dependent on the specific system used .

• What are the challenges in purifying recombinant LexA protein from L. plantarum?

  Purification of recombinant LexA from L. plantarum involves several technical challenges:

  1. Extraction efficiency: Cell wall structure of Gram-positive L. plantarum requires optimized lysis methods

  2. Protein stability: LexA may undergo autoproteolysis during purification, requiring careful buffer optimization with:

     • 50% glycerol for stability

     • 10 mM Tris-HCl (pH 7.5)

     • 2 mM EDTA

     • 100 mM NaCl

     • 5 mM mercaptoethanol to maintain protein integrity

  3. Purification strategy: Multiple chromatography steps are typically required for high purity

     • Recombinant LexA can be purified to >90% purity as measured by SDS-PAGE

     • Typical concentration of purified product is around 0.8 mg/ml

     • Purified LexA appears as a single band at approximately 23 kDa on SDS-PAGE

  4. Storage considerations: Long-term storage at -80°C is recommended after shipping at either 4°C or -20°C

Advanced Research Questions

• How can I verify the DNA-binding activity of recombinant L. plantarum LexA and identify its target sequences?

  Verification of DNA-binding activity requires multiple complementary approaches:

  1. Electrophoretic Mobility Shift Assay (EMSA):

     • Incubate purified recombinant LexA with labeled SOS box-containing DNA fragments

     • Include competition assays with unlabeled specific and non-specific DNA fragments

     • Analyze mobility shifts indicative of protein-DNA complex formation

  2. DNase I footprinting:

     • Identify protection patterns on target promoters

     • Map precise binding sites of LexA dimers to SOS box sequences

  3. Chromatin Immunoprecipitation (ChIP):

     • Use anti-LexA antibodies to precipitate LexA-DNA complexes

     • Sequence precipitated DNA to identify in vivo binding sites genome-wide

  4. Bioinformatic analysis:

     • Screen the L. plantarum genome for the canonical SOS box motif (TACTGTATATATATACAGTA)

     • Perform comparative genomics with closely related species

     • Analyze transcriptome data for co-regulated genes under DNA damage conditions

  Previous studies have identified the LexA regulon in L. plantarum through correlation analysis of co-regulated genes across multiple transcriptome datasets. A highly conserved palindromic sequence (GAAC-N4-GTTC) was identified as the binding site of LexA in L. plantarum, resembling known LexA binding sites in other bacterial species .

• What are the approaches to study RecA-mediated autoproteolysis of LexA in L. plantarum?

  To study the mechanism and kinetics of RecA-mediated LexA autoproteolysis:

  1. In vitro autoproteolysis assays:

     • Purify both RecA and LexA from L. plantarum

     • Prepare activated RecA by incubating with ssDNA and ATP/dATP

     • Monitor LexA cleavage over time using SDS-PAGE or Western blot

     • Quantify cleavage products using densitometry

  2. Site-directed mutagenesis studies:

     • Create point mutations in LexA's serine-lysine catalytic dyad

     • Assess effect on autoproteolysis rates and SOS response activation

     • Test resistance to autoproteolysis in vivo and in vitro

  3. Real-time monitoring techniques:

     • Utilize FRET-based assays with fluorescently labeled LexA

     • Monitor conformational changes and cleavage in real-time

  4. Structure-function analysis:

     • Compare L. plantarum LexA structure with well-characterized E. coli LexA

     • Identify unique features that might influence autoproteolysis kinetics

  Researchers should consider that LexA self-protease activity is environmentally sensitive, and experimental conditions should mimic cellular conditions of DNA damage response for physiologically relevant results .

• How can I use CRISPR/Cas9 technology to modify the lexA gene in L. plantarum?

  CRISPR/Cas9-assisted genome editing in L. plantarum for lexA modification involves several strategic steps:

  1. Design of CRISPR components:

     • Design sgRNA targeting lexA gene region with minimal off-target effects

     • Clone sgRNA into a suitable CRISPR/Cas9 expression vector for L. plantarum

  2. Homologous recombination template preparation:

     • Design dsDNA or ssDNA recombination templates with desired lexA modifications

     • Include homology arms of 500-1000 bp flanking the target site

  3. Two-step recombineering approach:

     • First, insert a selectable marker (e.g., antibiotic resistance) with loxP sites

     • After selection, use Cre recombinase to remove the marker

     • Use CRISPR/Cas9 targeting loxP sites for seamless editing

  4. Optimization of recombination efficiency:

     • Express recombinases (lp_0642, lp_0641, lp_0640) from prophage P1 locus

     • Overexpress endogenous adenine-specific methyltransferase to improve efficiency

  5. Verification of edits:

     • Screen transformants by PCR and sequencing

     • Validate functional changes through phenotypic analysis

  This approach has shown success in L. plantarum WCFS1, with efficiency of the two-step gene insertion reaching approximately 82% for the first step .

• What are the methodologies to study the LexA regulon and SOS response network in L. plantarum?

  Studying the complete LexA regulon requires an integrated systems biology approach:

  1. Transcriptome analysis:

     • Compare gene expression profiles between wild-type and lexA mutant strains

     • Analyze transcriptional changes after DNA damage using RNA-seq

     • Identify directly and indirectly regulated genes

  2. Independent component analysis:

     • Derive independently modulated genes (iModulons) from transcriptome data

     • Annotate iModulons for associated transcription factors and pathways

     • Identify active modules in response to different growth conditions

  3. Phylogenetic footprinting:

     • Compare upstream regions of orthologous genes across related species

     • Identify conserved LexA binding motifs

     • Distinguish species-specific from general regulatory elements

  4. Regulatory network reconstruction:

     • Build networks of co-regulated genes based on expression correlation

     • Identify TUs (transcriptional units) with correlated expression patterns

     • Study connectivity between different regulons

  Previous studies have reconstructed the LexA regulon in L. plantarum by analyzing more than 70 different experimental conditions and identifying TUs with correlated expression. This approach identified a high level of interconnectivity in the regulatory network, with many TUs belonging to multiple regulons and containing different regulatory motifs in their upstream regions .

• How does the LexA repressor in L. plantarum differ from LexA in other bacterial species?

  Comparative analysis of LexA across bacterial species reveals important evolutionary and functional differences:

  Feature	L. plantarum LexA	E. coli LexA	B. subtilis LexA
  Molecular weight	~23 kDa	~22 kDa	~23 kDa
  DNA binding motif	GAAC-N4-GTTC	CTGT-N8-ACAG	GAAC-N4-GTTC
  Regulon size	Moderate	Large (>40 genes)	Moderate
  Core genes regulated	recA, lexA, umuC, dinP	recA, lexA, umuDC, dinB	recA, lexA, uvrBA
  Unique regulon members	hsp1	sulA	yneA
  Gene organization	recA separate from cinA	-	-

  Key differences include:

  1. Recognition sequence: The LexA binding site in L. plantarum (GAAC-N4-GTTC) differs from the canonical E. coli SOS box

  2. Regulon composition: While core SOS genes are conserved, species-specific genes are also regulated:

     • L. plantarum's LexA regulon includes hsp1, which lacks an ortholog in B. subtilis

     • The gene organization differs, with recA not part of the same transcriptional unit as cinA in L. plantarum

  3. Evolutionary conservation: Phylogenetic analysis based on recA gene sequences shows clear differentiation between L. plantarum, L. pentosus, and L. paraplantarum, highlighting species-specific variations

  Understanding these differences is crucial for accurate reconstruction of the SOS regulatory network in L. plantarum and for engineering applications targeting the LexA system.

• How can I develop LexA-based genetic circuits in L. plantarum for controlling gene expression?

  Developing LexA-based genetic circuits requires sophisticated genetic engineering approaches:

  1. Design principles:

     • Identify and characterize LexA binding sites with different affinities

     • Engineer synthetic promoters with varying numbers and positions of SOS boxes

     • Develop non-cleaving LexA variants for stable repression

  2. DNA damage-responsive circuits:

     • Place target genes under control of LexA-regulated promoters

     • Engineer gradients of response sensitivity using modified SOS boxes

     • Enable DNA damage-triggered expression of therapeutic or reporter genes

  3. Multi-input logic gates:

     • Combine LexA regulation with other regulatory systems (e.g., PlacA, PxylA)

     • Create AND/OR logic gates responding to DNA damage AND specific inducers

     • Develop feedback loops for sustained or pulsed gene expression

  4. Testing and optimization:

     • Measure circuit performance using reporter genes (mCherry, GFP)

     • Optimize using the BioLector® micro-fermentation system

     • Validate circuit behavior through Western blot and functional assays

  5. Stability considerations:

     • Test circuit stability under various conditions:

       • Temperature (37°C and 50°C)

       • pH values (pH 1.5 to 7.0)

       • Bile salt concentrations (0-0.5%)

     • Ensure stable expression through multiple generations

  Research has shown that recombinant proteins expressed in L. plantarum can remain stable at 50°C for 20 minutes, at pH 1.5 for 30 minutes, and in the presence of bile salts, making this an attractive platform for engineered genetic circuits in various environments .

• What are the implications of lexA mutations on genome stability and evolution in L. plantarum?

  LexA mutations have profound effects on genome stability and evolutionary trajectories:

  1. Mutation frequency and genomic stability:

     • LexA-deficient strains show increased spontaneous mutation rates

     • Constitutive expression of error-prone polymerases in lexA mutants

     • Altered balance between high-fidelity and error-prone DNA repair

  2. Stress response and adaptation:

     • Modified stress tolerance profiles in lexA mutants

     • Altered horizontal gene transfer rates

     • Changes in mobile genetic element activity and prophage induction

  3. Experimental approaches:

     • Whole-genome sequencing of evolved lexA mutant lineages

     • Comparative genomics of wild-type vs. lexA mutants under stress

     • Fluctuation assays to quantify mutation rates

     • Adaptation experiments under varying selective pressures

  4. Analytical considerations:

     • Distinguish direct effects of lexA mutations from secondary adaptations

     • Account for population heterogeneity in evolved populations

     • Consider both beneficial and deleterious mutation accumulation

  These studies have implications for understanding probiotic strain stability, engineering more robust industrial strains, and predicting evolutionary outcomes in variable environments. Research should control for experimental variables such as growth phase, media composition, and environmental stressors when assessing genomic stability .

• How can I evaluate the immunomodulatory effects of recombinant L. plantarum expressing modified LexA proteins?

  Evaluating immunomodulatory effects requires comprehensive immunological assessment:

  1. In vitro evaluation:

     • Co-culture recombinant L. plantarum with dendritic cells, macrophages, or intestinal epithelial cells

     • Measure cytokine production (IL-4, IL-10, TNF-α, IFN-γ)

     • Assess changes in immune cell activation markers and maturation

  2. Ex vivo studies:

     • Culture recombinant strains with intestinal tissue explants

     • Evaluate tissue cytokine production and barrier function

  3. In vivo assessment:

     • Oral administration to appropriate animal models

     • Monitor both humoral and cellular immune responses:

       • Specific antibody production (IgG, IgA)

       • T-cell responses (CD4+/CD8+ profiles)

       • Cytokine profiles in serum and intestinal tissue

     • Assess immune cell populations in Peyer's patches and mesenteric lymph nodes

  4. Data analysis and interpretation:

     • Compare with appropriate controls (empty vector, wild-type strain)

     • Evaluate dose-dependent effects

     • Assess duration of immunomodulatory effects

  Meta-analysis of clinical trials has shown that L. plantarum can significantly affect cytokine levels: increasing IL-10 (+9.88 pg/mL) while decreasing IL-4 (-0.48 pg/mL), TNF-α (-2.34 pg/mL), and IFN-γ (-0.99 pg/mL) . These baseline immunomodulatory effects should be considered when evaluating recombinant strains expressing modified LexA proteins or other engineered components .