Recombinant Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni GTPase Der (der)

Basic Research Questions

• What are the genomic characteristics of Leptospira interrogans serovar Copenhageni versus serovar Icterohaemorrhagiae?

  L. interrogans serovars Copenhageni and Icterohaemorrhagiae, though closely related, exhibit distinct genetic differences. Genomic analyses of 67 isolates identified 1072 SNPs (single nucleotide polymorphisms), with 276 in non-coding regions and 796 in coding regions . Additionally, researchers identified 258 indels (insertions/deletions), with 191 in coding regions and 67 in non-coding regions .

  The most significant distinguishing feature is a frameshift mutation within a homopolymeric tract of the lic12008 gene (related to LPS biosynthesis) present in all L. interrogans serovar Icterohaemorrhagiae strains but absent in Copenhageni strains . This internal indel serves as a high-discriminatory genetic marker that can differentiate these serovars with exceptional accuracy.

  Phylogenetic analyses have demonstrated that both serovars remain highly conserved over time but show distinct geographical clustering patterns . Despite their genetic similarities, they maintain antigenic differences that may be explained by this key genetic variation.

• What is the structure and function of GTPase Der in Leptospira species?

  GTPase Der (also known as EngA) is a GTP-binding protein found in various Leptospira species. In L. borgpetersenii serovar Hardjo-bovis, the full-length Der protein consists of 487 amino acids . The protein contains characteristic GTPase motifs and domains essential for its function.

  Based on homology with other bacterial GTPases, Der likely plays crucial roles in:

  • Ribosome assembly and maturation

  • Cellular energy metabolism

  • Translation regulation

  • Stress response adaptation

  The Der protein structure includes multiple GTP-binding domains, making it a unique bacterial GTPase with potential roles in coordinating complex cellular processes. Due to Der's absence in mammalian cells in this specific form, it represents a potential target for antimicrobial development.

• How does Leptospira interrogans affect host endothelial cells during infection?

  L. interrogans causes significant quantitative and morphological changes in endothelial cells through multiple pathways including endothelial barrier damage and inflammation . Key cellular effects include:

  • Disruption of adherens junctions: The most prominent pathogenic phenotype is the drastic reduction of adherens junction proteins (VE-cadherin, p120 catenin, alpha-catenin, and beta-catenin) specifically at cell-cell junctions

  • Alteration of intracellular proteins:

    • Increased vascular endothelial growth factor (VEGF) by 1.1-1.9 fold with puncta formation

    • Elevated small GTPase RhoA by 1.3-1.4 fold (with pathogenic Copenhageni) and 1.1-1.2 fold (with non-pathogenic Patoc)

  • Modification of extracellular matrix (ECM) proteins:

    • Signal elevations and structural changes in collagen type IV and decorin

    • Laminin rearrangement into thick bundles specifically caused by pathogenic Copenhageni

  These cellular changes contribute to the loss of endothelial barrier integrity, which may explain the vascular leakage and hemorrhagic manifestations observed in severe leptospirosis.

Advanced Research Questions

• What molecular mechanisms differentiate the pathogenicity of Leptospira interrogans serovar Copenhageni from non-pathogenic Leptospira strains?

  The pathogenicity of L. interrogans serovar Copenhageni involves several distinctive molecular mechanisms when compared to non-pathogenic strains like L. biflexa serovar Patoc:

  a) Differential effects on junction proteins:

  • Pathogenic Copenhageni specifically disrupts adherens junctions by targeting VE-cadherin/catenin complexes

  • Tight junction markers (occludin and claudin) remain largely undisturbed, indicating specificity in the pathogenic mechanism

  b) Extracellular matrix effects:

  • Both pathogenic and non-pathogenic strains increase signals for collagen type IV and decorin, but with different intensities

  • Structural rearrangement of laminin is specifically caused by pathogenic Copenhageni

  c) Intracellular signaling differences:

  • VEGF signal increase is higher with pathogenic Copenhageni (1.9-fold) than with non-pathogenic Patoc (1.1-fold) in HMEC-1 cells

  • RhoA signal elevation is greater in response to pathogenic Copenhageni (1.3-1.4 fold) compared to non-pathogenic Patoc (1.1-1.2 fold)

  These pathogen-specific mechanisms suggest targeted virulence strategies have evolved in pathogenic Leptospira to disrupt endothelial barriers while preserving other cellular functions.

• How can structural analysis of GTPase Der inform functional studies in Leptospira interrogans?

  Structural analysis of GTPase Der provides crucial insights for functional studies through multiple approaches:

  a) Domain identification and functional prediction:

  • Der contains two GTPase domains with distinctive G1-G5 motifs that coordinate GTP binding and hydrolysis

  • Analysis of conserved residues across bacterial species can predict critical functional sites

  b) Nucleotide-binding state analysis:

  • Crystal structures in different nucleotide-bound states (GTP, GDP, nucleotide-free) would reveal conformational changes

  • These structural transitions likely coordinate interactions with ribosomes and other cellular components

  c) Interactome prediction:

  • Surface feature analysis can predict potential protein-protein interaction sites

  • Docking studies with ribosomal components can identify binding interfaces

  d) Inhibitor development:

  • Identification of unique structural features absent in mammalian GTPases

  • Structure-based drug design targeting GTP-binding pockets or protein-protein interaction sites

  A detailed structural understanding would facilitate targeted mutagenesis studies to correlate structure with pathogenesis and identify critical residues for GTPase function in the context of Leptospira virulence.

• What are the implications of the lic12008 frameshift mutation for Leptospira interrogans serovar Icterohaemorrhagiae virulence and evolution?

  The frameshift mutation within the lic12008 gene in L. interrogans serovar Icterohaemorrhagiae represents a distinctive genetic marker with several implications:

  a) Virulence impact:

  • Despite this mutation, serovar Icterohaemorrhagiae maintains virulence in hamster models similar to Copenhageni strains

  • Infection via both intraperitoneal and conjunctival routes shows pathogenicity is preserved

  b) Functional compensation mechanisms:

  • Paralogous genes may compensate for functional aberrations caused by this frameshift

  • Redundancy in LPS biosynthesis pathways likely preserves necessary functions

  c) Evolutionary significance:

  • The consistent presence of this mutation across Icterohaemorrhagiae isolates suggests positive selection

  • It may contribute to antigenic differences between serovars that influence host-pathogen interactions

  d) Diagnostic utility:

  • This mutation provides a reliable genetic marker to differentiate these closely related serovars

  • PCR-based detection using specific primers (5′TAGGTTGGCACGAAGGTTCT3′ and 5′TTTTTCCGGGAACTCCAAC3′) offers a practical diagnostic approach

  Understanding this mutation's functional consequences and evolutionary advantage requires further investigation of LPS structure and immunological properties between these serovars.

Methodological Considerations

• What are the optimal expression systems and purification strategies for producing functional recombinant GTPase Der from Leptospira interrogans?

  Producing functional recombinant GTPase Der requires careful consideration of expression systems and purification approaches:

  a) Expression systems comparison:

  Expression System	Advantages	Disadvantages	Optimal Conditions
  Mammalian cells	Native-like folding, post-translational modifications	Lower yield, higher cost	37°C, serum-free media for simplified purification
  E. coli	High yield, cost-effective, rapid growth	Potential inclusion body formation	16-25°C induction, BL21(DE3) or Rosetta strains
  Yeast (P. pastoris)	Eukaryotic processing, high-density culture	Longer development time	Methanol induction, 25-30°C

  b) Key purification considerations:

  • Affinity tags: His6-tag is preferred for minimal interference with GTPase activity

  • Buffer composition: Include 5-10 mM MgCl2 to stabilize nucleotide binding

  • Reducing agents: 1-5 mM DTT or 2-10 mM β-mercaptoethanol to prevent oxidation of cysteine residues

  • Glycerol (10-20%): To improve protein stability during storage

  c) Activity preservation strategies:

  • Rapid purification at 4°C to minimize proteolytic degradation

  • Inclusion of GTP or non-hydrolyzable GTP analogs (0.1-1 mM) during purification

  • Avoid freeze-thaw cycles by preparing single-use aliquots

  d) Quality control metrics:

  • Purity assessment by SDS-PAGE (target >85%)

  • Secondary structure verification by circular dichroism

  • Functional validation through GTPase activity assays

  The mammalian cell expression system has been successfully used for leptospiral proteins as seen with L. borgpetersenii Der , making it a recommended approach when native conformation is critical for functional studies.

• What methodologies are most effective for differentiating between Leptospira interrogans serovars Copenhageni and Icterohaemorrhagiae?

  Accurate differentiation between these closely related serovars requires a combination of methodologies:

  a) Molecular genetic approaches:

  • PCR-based detection of the lic12008 indel using specific primers

  • Sanger sequencing of the amplified product to confirm the frameshift mutation

  • Whole genome sequencing (WGS) for comprehensive genetic comparison

  b) Serological methods:

  • Microscopic agglutination test (MAT) using:

    • Polyclonal sera for confirming Icterohaemorrhagiae serogroup

    • Monoclonal sera for differentiating between serovars

  • Cross-absorption agglutination for definitive serotyping

  c) Comparative effectiveness:

  Method	Discriminatory Power	Technical Complexity	Time Required	Limitations
  lic12008 indel PCR	Very high	Low	4-6 hours	Requires sequence knowledge
  WGS	Highest	High	3-5 days	Expensive, requires bioinformatics
  MAT	Moderate	Moderate	1-2 days	Requires specific antisera
  Multilocus sequence typing	Moderate	Moderate	1-2 days	Limited for certain strains

  d) Recommended integrated approach:

  • Initial screening with lic12008 indel PCR

  • Confirmation with serological typing (MAT)

  • WGS for research requiring comprehensive genetic characterization

  This multi-method approach provides reliable differentiation crucial for epidemiological studies, diagnostic development, and pathogenesis research.

• What are the key considerations for developing GTPase activity assays specific to Leptospira interrogans Der protein?

  Developing robust GTPase activity assays for L. interrogans Der requires attention to several methodological aspects:

  a) Assay selection considerations:

  Assay Type	Principle	Sensitivity	Advantages	Limitations
  Malachite green	Colorimetric detection of released phosphate	0.1-5 nmol Pi	Simple, inexpensive	End-point measurement, potential interference
  HPLC-based	Direct separation of nucleotides	10-100 pmol	Quantitative, detects multiple nucleotides	Specialized equipment required
  Fluorescent (FRET)	Conformational changes upon GTP binding/hydrolysis	1-10 nM protein	Real-time kinetics, high-throughput compatible	Requires protein engineering
  Radioactive [γ-32P]GTP	Detection of released 32Pi	0.1-1 pmol	Highest sensitivity	Radioactive material handling, waste disposal

  b) Buffer optimization parameters:

  • pH range: 7.0-8.0 (optimal typically 7.5)

  • Divalent cations: 5-10 mM MgCl2 (essential for activity)

  • Monovalent ions: 50-150 mM KCl or NaCl

  • Reducing agent: 1 mM DTT to maintain cysteine residues

  c) Reaction conditions optimization:

  • Temperature dependence: Test range from 25°C-40°C

  • GTP concentration: 1 μM-1 mM for Km determination

  • Protein concentration: 50-500 nM, depending on specific activity

  • Time course: Linear range typically 5-30 minutes

  d) Controls and validation:

  • GTPase-dead mutant (K to A mutation in P-loop)

  • Non-hydrolyzable GTP analogs (GTPγS, GMPPNP)

  • Commercial GTPases with known activity (e.g., Ras, EF-Tu)

  These considerations ensure the development of reliable, reproducible assays for characterizing Der's enzymatic properties and screening potential inhibitors.

Research Applications

• How can recombinant GTPase Der be utilized for vaccine development against Leptospira interrogans?

  Recombinant GTPase Der offers several strategic approaches for Leptospira vaccine development:

  a) Antigen design considerations:

  • Full-length Der protein (487 amino acids) may provide multiple epitopes

  • Conserved epitopes across Leptospira species could provide cross-protection

  • Domain-specific fragments targeting regions absent in mammalian GTPases

  b) Vaccine platform options:

  Platform	Advantages	Challenges	Development Requirements
  Subunit vaccine	Defined composition, safety	Lower immunogenicity	Adjuvant optimization, stability testing
  DNA vaccine	Cell-mediated response, stability	Delivery efficiency	Codon optimization, delivery vehicle
  Recombinant vector	Strong immune response	Pre-existing vector immunity	Vector selection, insert stability
  Epitope-based	Focused immune response, safety	Epitope identification	Bioinformatic analysis, epitope mapping

  c) Adjuvant selection strategies:

  • Aluminum salts for antibody-focused responses

  • TLR agonists for balanced humoral/cellular immunity

  • Liposomal formulations for antigen protection and targeting

  d) Efficacy assessment guidelines:

  • Challenge models using hamsters (proven effective for virulence studies)

  • Multiple routes of infection testing (intraperitoneal, conjunctival)

  • Cross-protection evaluation against both Copenhageni and Icterohaemorrhagiae serovars

  • Sterilizing immunity vs. disease protection differentiation

  While Der's intracellular location might limit antibody accessibility, T-cell responses against Der-derived peptides could provide cell-mediated protection. Combining Der with surface-exposed antigens might create more effective multivalent vaccines.

• What are the critical parameters for studying GTPase Der inhibitors as potential anti-Leptospira therapeutics?

  Developing Der inhibitors as anti-Leptospira therapeutics requires systematic evaluation of several critical parameters:

  a) Target-based screening considerations:

  • Assay development: Optimized GTPase activity assays with Z' factor >0.7

  • Compound libraries: Diversity-oriented, fragment-based, and natural product collections

  • Initial screening concentrations: Typically 1-10 μM for primary screens

  • Hit confirmation criteria: Dose-response curves with IC50 <10 μM, Hill slope ~1

  b) Structure-activity relationship (SAR) analysis:

  Parameter	Assessment Method	Acceptance Criteria	Significance
  Binding mode	Crystallography, molecular modeling	Clear electron density, energetically favorable	Guides medicinal chemistry optimization
  Specificity	Counter-screening against mammalian GTPases	>100-fold selectivity	Minimizes off-target effects
  Physicochemical properties	ADME assays, solubility testing	Aqueous solubility >50 μM, LogP 1-3	Ensures drug-like behavior
  Antimicrobial activity	MIC determination	MIC <10 μg/mL against diverse strains	Demonstrates on-target efficacy

  c) In vitro efficacy validation:

  • Endothelial cell infection models (HMEC-1, HDLEC)

  • Monitoring protection against adherens junction disruption

  • Assessment of intracellular bacterial load reduction

  • Cytotoxicity evaluation (CC50/IC50 ratio >10)

  d) In vivo efficacy requirements:

  • Pharmacokinetic profiling (dosing regimen determination)

  • Hamster model of infection via multiple routes

  • Endpoints: Survival, bacterial burden, histopathological changes

  • Comparison against standard antibiotic therapy (doxycycline, penicillin)

  This systematic approach would identify promising Der inhibitors with potential for development as novel leptospirosis therapeutics, particularly valuable for drug-resistant cases or in combination therapy approaches.

• How does the RhoA-mediated pathway interact with endothelial integrity during Leptospira interrogans infection, and what role might GTPase Der play?

  The interplay between RhoA signaling, endothelial integrity, and potential GTPase Der involvement during L. interrogans infection represents a complex pathogenic mechanism:

  a) RhoA pathway activation during infection:

  • L. interrogans infection increases RhoA signal intensity by 1.3-1.4 fold with pathogenic Copenhageni

  • RhoA activation leads to actin cytoskeleton remodeling observed in infected cells

  • This activation correlates with adherens junction disruption at cell-cell contacts

  b) Endothelial integrity disruption mechanisms:

  Cellular Component	Effect During Infection	Quantitative Change	Consequence
  VE-cadherin/catenin complex	Signal reduction at junctions	Dramatic decrease	Loss of cell-cell adhesion
  Actin cytoskeleton	Remodeling	Significant rearrangement	Altered cellular mechanics
  RhoA	Signal elevation	1.3-1.4 fold increase	Cytoskeletal contractility
  Extracellular matrix proteins	Structural changes	Varied (protein-dependent)	Modified cell-matrix interactions

  c) Potential role of bacterial GTPase Der:

  • Der-dependent protein synthesis may be required for virulence factor production

  • Virulence factors likely include molecules that activate host RhoA pathways

  • Der may regulate stress responses during host cell interaction

  • Der activity could influence outer membrane protein expression required for adhesion

  d) Experimental approaches to investigate this interplay:

  • Generation of conditional Der mutants to assess impact on RhoA activation

  • Proteomic analysis of RhoA-associated complexes during infection

  • Transcriptomic profiling of host responses to Der-deficient vs. wild-type bacteria

  • Live-cell imaging with fluorescent biosensors to monitor RhoA activity during infection

  Understanding this interplay could reveal novel intervention points for preserving endothelial barrier function during leptospirosis, potentially reducing vascular leakage and hemorrhagic complications that contribute to disease severity.