Recombinant Macaca fascicularis Probable cation-transporting ATPase 13A3 (ATP13A3)

What is ATP13A3 and to which protein family does it belong?

ATP13A3 is a member of the P-type ATPase family of proteins that transport various cations across membranes. Specifically, it belongs to the P5B-ATPase subfamily, which has been identified as components of the mammalian polyamine transport system. P-type ATPases utilize ATP hydrolysis to drive ion transport, with ATP13A3 particularly involved in polyamine transport across cellular membranes .

Other P-type ATPases that share structural similarities include ATP7B and ATP7A, though these transport different cations. Within the P5B-ATPase subfamily, ATP13A3 has related members including ATP13A1, ATP13A4, and ATP13A5, which may have overlapping but distinct functions .

What are the primary biochemical functions of ATP13A3?

ATP13A3 demonstrates several biochemical activities essential to its function:

• ATP binding - Required for energizing the transport mechanism

• ATPase activity - Hydrolyzes ATP to drive conformational changes necessary for transport

• Cation-transporting ATPase activity - Specifically moves polyamine cations across membranes

• Hydrolase activity - General enzymatic function related to its ATPase role

• Metal ion binding - May contribute to its structure or regulatory mechanisms

These functions enable ATP13A3 to serve as a critical component of the polyamine transport system, facilitating the cellular uptake of polyamines such as putrescine, spermidine, and spermine .

How is ATP13A3 expression regulated in different tissues and disease states?

ATP13A3 expression demonstrates tissue-specific patterns and can be altered in pathological conditions. In neuroblastoma, high ATP13A3 expression correlates with poor patient survival outcomes. This association has been demonstrated in multiple patient cohorts as shown in the following multivariate analysis:

Even when controlling for other prognostic factors like disease stage, age, and MYCN amplification status, ATP13A3 expression remains a significant predictor of outcome .

Expression can be quantified using RT-PCR with the following primers:

• Forward primer: TACTGTGGAGCACTGATG

• Reverse primer: GAGTTGCCACCATGTCATGC

What evidence supports ATP13A3's role in polyamine transport?

Multiple lines of evidence establish ATP13A3 as a critical component of the mammalian polyamine transport system:

• CHO-MG cells with mutations in ATP13A3 show polyamine uptake deficiency and resistance to the toxic polyamine biosynthesis inhibitor methylglyoxal bis-(guanylhydrazone) (MGBG)

• Reintroduction of wild-type ATP13A3 into CHO-MG cells restores polyamine uptake capacity and MGBG sensitivity

• Knockdown of ATP13A3 in wild-type cells induces a phenotype characterized by decreased putrescine uptake and MGBG resistance

• ATP13A3 is expressed in early and recycling endosomes, consistent with its role in transport

• In neuroblastoma cells, ATP13A3 knockdown limits both basal and DFMO-induced polyamine uptake, confirming its role in polyamine transport mechanisms

These findings collectively identify ATP13A3 as a major component of the mammalian polyamine transport system with particular importance for putrescine uptake.

How does pharmacological inhibition of polyamine transport affect ATP13A3 function?

The polyamine transport inhibitor AMXT 1501 has been shown to target ATP13A3-mediated polyamine uptake. When neuroblastoma cells overexpress ATP13A3, they exhibit increased polyamine uptake that can be effectively inhibited by AMXT 1501 treatment .

This pharmacological finding provides both:

• Further confirmation of ATP13A3's role in polyamine transport

• A mechanistic explanation for how polyamine transport inhibitors work in combinatorial therapeutic approaches

Researcher workflows typically include pre-treatment with AMXT 1501 overnight followed by polyamine challenge experiments to assess transport inhibition. Such experiments are generally performed in the presence of aminoguanidine (1 mM) to eliminate potential cytotoxic effects from byproducts generated by serum amine oxidases acting on extracellular polyamines .

How do changes in polyamine biosynthesis affect ATP13A3-mediated transport?

When polyamine biosynthesis is inhibited using difluoromethylornithine (DFMO), which targets ornithine decarboxylase (ODC1), cells compensate by upregulating polyamine uptake mechanisms. Research has demonstrated that ATP13A3 plays a critical role in this compensatory response:

• Neuroblastoma cells treated with DFMO show increased polyamine uptake

• ATP13A3 knockdown limits this DFMO-induced polyamine uptake

• Combined treatment with DFMO and ATP13A3 inhibition (either through gene silencing or AMXT 1501) more effectively inhibits neuroblastoma cell growth than either approach alone

This compensatory mechanism explains why polyamine biosynthesis inhibition alone may have limited therapeutic efficacy, and supports combination approaches targeting both biosynthesis and transport pathways.

What are the recommended approaches for modulating ATP13A3 expression in experimental systems?

Several validated approaches have been successfully employed to modulate ATP13A3 expression:

Stable knockdown systems:

Validated microRNA (miR) based short-hairpin lentiviral vectors targeting three different regions:

• mirKD1: AATCACAACAGATTCGTTATTT

• mirKD-2: TCAATCGTAAGCTCACTATATT

• mirKD-3: AGACCACCTTCGGGTCTTATAT

miRNA targeting Firefly Luciferase (mirFLUC: ACGCTGAGTACTTCGAAATGTC) serves as a negative control .

Transient knockdown systems:

Multiple independent siRNAs with the following sequences:

• ATP13A3 siKD-1: GGUCAUAAUUAUCGAGUCU

• ATP13A3 siKD-2: AGUCUUCUCUCGUAGGUUA

• ATP13A3 siKD-3: AGAAACACAUAAACGACAU

• ATP13A3 siKD-4: CAAUUGACCCAGAGGCUAU

These can be transfected using RNAiMAX according to manufacturer's instructions .

Overexpression systems:

Lentiviral transduction systems for:

• Wild-type human ATP13A3

• Catalytically dead D498N ATP13A3 mutant (useful as negative control)

• Control constructs (e.g., Firefly Luciferase)

Selection is typically maintained with 2 μg/mL puromycin for overexpression models or 5 μg/mL blasticidin for knockdown models .

What cell culture systems are appropriate for ATP13A3 functional studies?

Multiple cell types have been validated for ATP13A3 research:

• CHO-MG cells - A model system with ATP13A3 mutations that presents polyamine uptake deficiency; useful for studying ATP13A3 complementation

• Neuroblastoma cell lines:

  • SH-SY5Y (CRL-2266, RRID:CVCL_0019)

  • KELLY (ACC354, RRID:CVCL_2092)

  • BE(2)-C (CRL-2268, RRID:CVCL_0529)

  • Tet-21/N (RRID:CVCL_9812)

Typical culture conditions include:

• For SH-SY5Y and BE(2)-C: DMEM + 10% FBS

• For KELLY and Tet-21/N: RPMI medium with 10-15% FBS

• For modified cell lines: appropriate selection antibiotics as described above

• Maintenance at 5% CO₂ and 37°C

• Passage using trypsin EDTA solution and PBS without magnesium and calcium

How can ATP13A3 transport activity be effectively measured?

Several complementary approaches can be used to assess ATP13A3 transport activity:

• Radiolabeled polyamine uptake assays - Direct measurement of polyamine transport using labeled putrescine, spermidine or spermine

• Growth inhibition in the presence of MGBG - ATP13A3 function correlates with sensitivity to this toxic polyamine biosynthesis inhibitor

• MUH (4-methylumbelliferyl heptanoate) viability assays - Used to assess the cytotoxic effects of polyamine pathway modulators; should be performed with aminoguanidine (1 mM) to eliminate potential cytotoxic effects of byproducts generated by serum amine oxidases

• Compensation for DFMO treatment - Measuring the ability of cells to overcome polyamine biosynthesis inhibition through ATP13A3-mediated uptake

These functional assays, particularly when combined with genetic modulation of ATP13A3, provide robust assessment of transport activity.

How do ATP13A3 variants contribute to pulmonary arterial hypertension pathogenesis?

Potential loss-of-function variants of ATP13A3 have been identified in patients with pulmonary arterial hypertension (PAH). While the complete mechanism remains under investigation, research suggests these variants may contribute to disease through disruption of normal vascular endothelial cell function .

The identification of these variants has established ATP13A3 as a PAH-associated gene, extending our understanding of the genetic landscape of this disease. Ongoing research is exploring how these variants specifically alter endothelial cell biology and contribute to the vascular remodeling characteristic of PAH .

What is the role of ATP13A3 in neuroblastoma progression?

ATP13A3 plays a significant role in neuroblastoma progression through its function in polyamine transport. Key findings include:

• High ATP13A3 expression correlates with poor survival in neuroblastoma patients (see table in section 1.3)

• ATP13A3 knockdown attenuates both MYCN-amplified and non-MYCN-amplified neuroblastoma cell growth

• ATP13A3 mediates both basal and DFMO-induced polyamine uptake in neuroblastoma cells

• ATP13A3 is a critical target of AMXT 1501, a polyamine transport inhibitor with therapeutic potential

• Combined targeting of polyamine biosynthesis (via DFMO) and transport (via ATP13A3 inhibition) shows enhanced anti-tumor effects

These findings suggest that ATP13A3 represents a novel therapeutic target in neuroblastoma, particularly in combination with polyamine biosynthesis inhibitors like DFMO.

How does ATP13A3 interact with other components of the polyamine homeostasis system?

While ATP13A3 has been identified as a key component of the polyamine transport system, its interactions with other elements of polyamine homeostasis remain an active area of investigation. Researchers should consider:

• Potential coordination between ATP13A3 and other P5B-ATPases (ATP13A1, ATP13A2, ATP13A4, ATP13A5) which may have overlapping functions

• Interactions with ODC1-mediated polyamine biosynthesis pathways, particularly in contexts where biosynthesis is inhibited

• Possible interactions with SLC3A2, another protein implicated in the polyamine transport system

• Subcellular localization in early and recycling endosomes, suggesting a specific role in sorting or recycling of polyamines

Understanding these network interactions is crucial for developing effective targeting strategies for diseases where polyamine homeostasis is dysregulated.

How do ATP13A3 catalytic mechanisms differ from other P-type ATPases?

ATP13A3 belongs to the P-type ATPase family but has distinct characteristics:

• As a P5B-ATPase, ATP13A3 appears specialized for polyamine transport, differentiating it from other P-type ATPases that transport different cations (e.g., ATP7B and ATP7A)

• The D498N mutation renders ATP13A3 catalytically inactive, suggesting this residue is critical for its ATPase function

• The catalytic mechanism likely involves conformational changes driven by ATP hydrolysis, typical of P-type ATPases, but with substrate specificity for polyamines rather than simple metal ions

Advanced structural and functional studies comparing ATP13A3 with other family members would provide greater insight into its unique mechanistic properties.

What is the comparative function of ATP13A3 across different species?

Recombinant ATP13A3 proteins from various species can be used to explore evolutionary conservation and species-specific functions:

While the core function in polyamine transport appears conserved, species-specific differences may exist in regulation, expression patterns, or exact substrate preferences .

Comparative functional studies using these different species variants could provide insights into conserved mechanisms and species-specific adaptations in polyamine transport systems.