Recombinant Macaca mulatta G-protein coupled receptor 56 (GPR56)

What is GPR56 and what are its alternative nomenclatures in scientific literature?

GPR56 in Macaca mulatta is a G-protein coupled receptor that belongs to the adhesion G protein-coupled receptor family. In scientific literature, this protein is known by several alternative names including ADGRG1 (Adhesion G protein-coupled receptor G1), G-protein coupled receptor 56, and Protein TM7XN1 . The standardized nomenclature has evolved over time, with ADGRG1 becoming the officially recommended name in recent literature, though GPR56 remains commonly used in research publications .

The receptor exists in multiple fragments that serve different functions: the N-terminal fragment (GPR56 NT or GPR56(N)) which forms the extracellular subunit (also called GPR56 subunit alpha), and the C-terminal fragment (GPR56 CT or GPR56(C)) . Understanding this nomenclature is essential when searching literature databases and interpreting research findings across different publication timelines.

What experimental systems are available for producing recombinant Macaca mulatta GPR56?

Multiple expression systems have been developed for producing recombinant Macaca mulatta GPR56 with high purity and functionality. Cell-free expression systems represent one of the primary methods, consistently yielding preparations with ≥85% purity as determined by SDS-PAGE analysis . This approach offers advantages in speed and the ability to produce proteins that might be toxic to host cells.

For researchers requiring different expression contexts, alternative systems including E. coli, yeast, baculovirus, and mammalian cell expression systems are also documented . These systems offer different advantages depending on research needs:

• E. coli systems: Higher yield but may lack post-translational modifications

• Yeast systems: Intermediate yield with some eukaryotic modifications

• Baculovirus systems: Good for complex proteins requiring insect cell modifications

• Mammalian cell systems: Most physiologically relevant modifications but typically lower yield

Each system should be selected based on the specific experimental requirements, particularly considering whether native post-translational modifications are essential for the planned functional studies.

How does GPR56 expression and function compare between Macaca mulatta and other species?

Comparative analysis shows that GPR56 is highly conserved across primates, with recombinant versions available from multiple species including Macaca mulatta, Pongo pygmaeus, Pan troglodytes, and Gorilla gorilla gorilla . This conservation suggests important evolutionary preservation of GPR56 function.

Mouse models (Mus musculus) have been extensively used to study GPR56 function, particularly in relation to neurological processes. Studies demonstrate that Gpr56 knockdown in mouse prefrontal cortex (PFC) is associated with depressive-like behaviors, executive dysfunction, and diminished response to antidepressant treatment . These findings have translational relevance to primate models, suggesting conserved neurological functions.

The rhesus macaque (Macaca mulatta) represents an especially valuable model for translational research due to its closer phylogenetic relationship to humans compared to rodents. This species has been utilized in numerous biomedical research areas including infectious disease, vaccine development, aging, cardiovascular disease, metabolic diseases, neurologic disorders, addiction studies, and cancer research . The physiological and neuroanatomical similarities between rhesus macaques and humans make findings regarding GPR56 function potentially more directly translatable to human clinical applications.

What are the recommended protocols for quantifying GPR56 expression in Macaca mulatta samples?

Quantitative real-time PCR (qRT-PCR) represents the gold standard for measuring GPR56 expression in Macaca mulatta samples. Based on established protocols, researchers should follow this methodological approach:

• RNA Extraction and Reverse Transcription:

  • Extract total RNA from tissue samples

  • Reverse transcribe using a high-capacity cDNA reverse transcription kit with oligo(dT) primers

• PCR Reaction Setup:

  • Use TaqMan Universal PCR Master Mix II (no UNG) or equivalent SYBR green chemistry

  • Employ validated primers specific for Macaca mulatta GPR56

  • Include appropriate reference genes such as GAPDH or CRYL1

• Amplification Conditions:

  • Initial denaturation: 10 minutes at 95°C

  • 50 cycles of:

    • 15 seconds at 95°C (denaturation)

    • 1 minute at 60°C (annealing/extension)

• Data Analysis:

  • Calculate expression using either absolute quantification (standard curve method) or relative quantification (2^-ΔΔCt method)

  • Normalize to validated reference genes like GAPDH

For SYBR green-based detection, validated primer sequences include:

• GPR56 Forward: TCCAGGCATACTCGCTGTTGCT

• GPR56 Reverse: CTTCTCACCCAGGACTTGGCTA

For TaqMan-based detection, commercial probe assays (Hs00173754_m1) have been successfully employed for GPR56 expression analysis . All reactions should be performed in triplicate with appropriate quality controls to ensure reliable quantification.

How can researchers effectively validate GPR56 antibodies for studies in Macaca mulatta tissues?

Antibody validation is critical for ensuring reliable detection of GPR56 in Macaca mulatta tissues. A comprehensive validation approach should include:

• Initial Selection Criteria:

  • Choose antibodies raised against conserved epitopes between human and macaque GPR56

  • Prioritize monoclonal antibodies for higher specificity

  • Consider host species to avoid cross-reactivity in downstream applications

• Validation by Western Blot:

  • Use purified recombinant Macaca mulatta GPR56 as a positive control

  • Verify detection of both full-length protein and its known fragments (N-terminal and C-terminal fragments)

  • Confirm specificity through absence of signal in negative controls

• Immunohistochemistry Validation:

  • Include GPR56-knockout tissues or siRNA-treated cells as negative controls

  • Assess staining patterns to ensure they match known cellular/subcellular localization

  • Perform peptide competition assays to confirm specificity

• Cross-Reactivity Assessment:

  • Test against other adhesion G-protein coupled receptors to rule out non-specific binding

  • Evaluate performance in tissues with known expression patterns

• Functional Validation:

  • Confirm antibody efficacy in neutralization or immunoprecipitation assays

  • Assess ability to detect native versus denatured forms depending on intended application

Mouse monoclonal antibodies against human GPR56 have shown reactivity with Macaca mulatta samples and have been successfully employed in Western blot and ELISA applications . For optimal results, researchers should thoroughly document validation data and report antibody clone identifiers (e.g., clone 1443CT377.65.29) to ensure experimental reproducibility.

What purification approaches yield the highest quality recombinant Macaca mulatta GPR56?

Obtaining high-purity recombinant Macaca mulatta GPR56 requires careful consideration of expression and purification strategies. Based on established protocols, the following approaches yield consistent results:

• Expression System Selection:

  • Cell-free expression systems consistently produce recombinant Macaca mulatta GPR56 with ≥85% purity as determined by SDS-PAGE

  • Alternative expression in E. coli, yeast, baculovirus, or mammalian cells may be selected based on specific experimental requirements

• Affinity Purification:

  • Incorporate affinity tags (His, GST, or FLAG) to facilitate purification

  • Use immobilized metal affinity chromatography (IMAC) for His-tagged proteins

  • Apply stringent washing conditions to remove non-specifically bound proteins

• Secondary Purification Steps:

  • Size exclusion chromatography to separate monomeric from aggregated forms

  • Ion exchange chromatography for further purification based on charge properties

  • Remove affinity tags through proteolytic cleavage if they might interfere with functional studies

• Quality Control Assessment:

  • Confirm purity using SDS-PAGE analysis (target: ≥85%)

  • Verify identity through mass spectrometry

  • Assess functional integrity through ligand binding or signaling assays

For studies requiring particularly high purity (>95%), additional chromatographic steps may be necessary. Researchers should carefully balance purification stringency against protein yield and activity, as excessive purification steps may compromise the functional integrity of the recombinant protein.

How does GPR56 expression correlate with antidepressant response in experimental models?

Research using animal models has established significant correlations between GPR56 expression and antidepressant response. The following methodological approaches have revealed important insights:

• Expression Analysis in Treatment Contexts:

  • qRT-PCR analysis demonstrates altered GPR56 expression patterns in response to antidepressant treatment

  • Both absolute quantification (standard curve method) and relative quantification (2^-ΔΔCt method) have been employed to measure expression changes

• Functional Modulation Studies:

  • GPR56 knockdown in mouse prefrontal cortex (PFC) has been associated with:

    • Development of depressive-like behaviors

    • Executive dysfunction

    • Poor response to antidepressant treatment

  • These findings suggest GPR56 may play a causal role in treatment response mechanisms

• Receptor Agonist Investigations:

  • Synthetic peptide agonists (P7 and P19) targeting GPR56 have been evaluated for antidepressant-like effects

  • Administration protocols typically involve bilateral infusion into specific brain regions including:

    • Prefrontal cortex (PFC) (coordinates: AP +1.9; ML +/- 0.5; DV -1.3)

    • Nucleus accumbens (NAcc) (coordinates: AP +1.6; ML +/- 0.7; DV -3.3)

For researchers designing studies to investigate GPR56's role in antidepressant response, it is recommended to employ complementary approaches including expression analysis, knockdown/knockout studies, and pharmacological activation. This multifaceted strategy provides stronger evidence for causal relationships between GPR56 signaling and treatment outcomes.

What are the methodological considerations when using GPR56 agonists in behavioral studies?

When investigating GPR56 agonists in behavioral studies, researchers should follow these methodological guidelines to ensure reliable and interpretable results:

• Agonist Selection and Preparation:

  • Synthetic peptides P7 and P19 have established efficacy as GPR56 agonists

  • Include appropriate control peptides (e.g., modified inactive peptide P19 Y->N: "TNFAVLMQLSPALVPAELL-NH2")

  • Prepare stock solutions in compatible vehicles (80% saline + 10% DMSO + 10% Cremophor has been validated)

• Dose Determination:

  • Establish dose-response relationships (e.g., P7 has been tested at 0.5 mM, 1 mM, and 2 mM concentrations)

  • Consider pharmacokinetic properties when determining timing between administration and behavioral testing

• Administration Protocol:

  • For targeted brain region delivery:

    • Perform stereotaxic surgery for cannula implantation

    • Allow sufficient recovery period (minimum 7 days post-surgery)

    • Infuse compounds using a precision pump at controlled rates (e.g., 0.5 μl/min)

    • Maintain infusion needles in place for 2 minutes post-administration to ensure diffusion

• Behavioral Testing:

  • Conduct behavioral assessments at appropriate timepoints (e.g., 30 minutes post-infusion for tail suspension test)

  • Include multiple behavioral paradigms to comprehensively assess effects

  • Minimize handling stress and environmental variables

• Verification Procedures:

  • Confirm cannula placement through post-mortem histological analysis

  • Validate agonist activity through molecular readouts of GPR56 pathway activation

  • Document any adverse effects or off-target behaviors

How can researchers design experiments to investigate functional interactions between GPR56 and neurotransmitter systems?

Investigating interactions between GPR56 and neurotransmitter systems requires carefully designed experiments spanning molecular, cellular, and behavioral levels. A comprehensive experimental design should include:

• Receptor Co-localization Studies:

  • Perform double immunofluorescence labeling to identify:

    • Brain regions where GPR56 and specific neurotransmitter receptors are co-expressed

    • Cell types (neurons vs. glia) expressing both receptor systems

    • Subcellular localization patterns

• Signaling Pathway Cross-talk Analysis:

  • Utilize phosphoprotein array or Western blot analysis to determine:

    • Common downstream effectors between GPR56 and neurotransmitter pathways

    • Temporal dynamics of pathway activation

    • Competition or synergy in second messenger systems

• Electrophysiological Approaches:

  • Employ patch-clamp recording to assess:

    • Effects of GPR56 activation on neuronal firing properties

    • Modulation of neurotransmitter-induced currents by GPR56 agonists

    • Synaptic plasticity changes in response to dual receptor manipulation

• Behavioral Paradigms:

  • Design factorial experiments combining:

    • GPR56 modulation (agonists, antagonists, or genetic manipulation)

    • Neurotransmitter system interventions (agonists, antagonists, reuptake inhibitors)

  • Assess interactions across multiple behavioral domains including:

    • Mood-related behaviors

    • Cognitive function

    • Motor activity

    • Reward processing

• In vivo Microdialysis:

  • Measure neurotransmitter release dynamics in response to GPR56 modulation

  • Assess region-specific effects in areas like prefrontal cortex and nucleus accumbens

  • Determine concentration-effect relationships across treatments

Based on existing research showing GPR56 involvement in antidepressant response , particular attention should be paid to interactions with monoaminergic systems (serotonin, norepinephrine, dopamine) that are targeted by conventional antidepressants. All experiments should include appropriate controls and sufficient sample sizes to detect interaction effects, which typically require greater statistical power than main effects alone.

What emerging techniques are advancing our understanding of GPR56 structure-function relationships?

Cutting-edge methodological approaches are transforming our understanding of GPR56 structure-function relationships. Researchers at the forefront of this field are employing:

• Cryo-Electron Microscopy (Cryo-EM):

  • Enables visualization of GPR56 in native-like environments

  • Reveals conformational changes upon ligand binding

  • Provides insights into receptor activation mechanisms

  • Particularly valuable for capturing different functional states

• Advanced Protein Engineering Approaches:

  • GPCR stabilization through directed evolution

  • Nanobody development for conformational stabilization

  • Incorporation of biorthogonal amino acids for site-specific labeling

  • Creation of GPR56 chimeras to identify functional domains

• Molecular Dynamics Simulations:

  • Computational modeling of receptor dynamics in membrane environments

  • Prediction of ligand binding sites and binding energetics

  • Identification of allosteric sites for drug development

  • Simulation of receptor activation trajectories

• Single-Molecule Techniques:

  • Fluorescence resonance energy transfer (FRET) to measure conformational changes

  • Single-particle tracking to monitor receptor diffusion and clustering

  • Super-resolution microscopy to visualize receptor organization in cell membranes

  • Atomic force microscopy to measure receptor-ligand binding forces

• Proteomics-Based Interactome Mapping:

  • Proximity labeling methods (BioID, APEX) to identify context-specific protein interactions

  • Cross-linking mass spectrometry to capture transient interactions

  • Temporal analysis of signaling complexes following receptor activation

These advanced techniques are particularly valuable for understanding the unique structural features of adhesion GPCRs like GPR56, which contain both an N-terminal fragment (GPR56 NT) and C-terminal fragment (GPR56 CT) . Integrating data from these complementary approaches provides a comprehensive view of GPR56 function that can inform therapeutic development targeting this receptor.

How should researchers approach experimental design when investigating species differences in GPR56 function?

Investigating species differences in GPR56 function requires rigorous experimental design to ensure valid cross-species comparisons. Researchers should implement the following methodological framework:

• Sequence-Function Correlation Analysis:

  • Compare GPR56 sequences across species (human, Macaca mulatta, Pongo pygmaeus, Pan troglodytes, etc.)

  • Identify conserved domains versus variable regions

  • Generate phylogenetic trees to map evolutionary relationships

  • Correlate sequence variations with known functional differences

• Parallel Expression System Comparisons:

  • Express GPR56 from multiple species in identical cellular contexts

  • Standardize expression levels through calibrated expression systems

  • Measure key parameters including:

    • Receptor trafficking and surface expression

    • Ligand binding affinity and specificity

    • G-protein coupling preferences

    • Signaling pathway activation kinetics

• Comparative Tissue Expression Profiling:

  • Analyze expression patterns across equivalent tissues from different species

  • Employ identical RNA extraction and qRT-PCR protocols for direct comparability

  • Map expression differences to functional outcomes

  • Consider developmental timing differences between species

• Cross-Species Pharmacological Profiling:

  • Test identical compounds (e.g., P7 and P19 peptides) across species

  • Determine EC50/IC50 values for standardized comparison

  • Identify species-specific pharmacological responses

  • Document differences in off-target effects

• Translational Behavioral Models:

  • Develop behavioral paradigms with cross-species validity

  • Account for species-specific behavioral repertoires

  • Correlate molecular mechanisms to behavioral outcomes

  • Consider evolutionary adaptations that might influence receptor function

When designing these studies, researchers must be particularly mindful of the physiological and neuroanatomical similarities between rhesus macaques and humans that make findings potentially more translatable to human clinical applications . All experimental protocols should be standardized to minimize technical variables that could be misinterpreted as true species differences.

What statistical approaches are recommended for analyzing GPR56 expression data in treatment response studies?

Robust statistical analysis is essential for interpreting GPR56 expression data in treatment response studies. The following statistical approaches are recommended:

• Preliminary Data Assessment:

  • Test for normality using Shapiro-Wilk or Kolmogorov-Smirnov tests

  • Evaluate homogeneity of variance using Levene's test

  • Identify and address outliers using standardized approaches

  • Transform data if necessary to meet parametric test assumptions

• Experimental Design-Appropriate Tests:

  • For two-group comparisons: Independent t-tests or Mann-Whitney U tests (non-parametric)

  • For multiple group comparisons: One-way ANOVA followed by appropriate post-hoc tests (Tukey, Bonferroni, or Dunnett)

  • For factorial designs: Two-way or multi-way ANOVA to assess interaction effects

  • For repeated measures: Repeated measures ANOVA or mixed-effects models

• Correlation and Regression Analyses:

  • Pearson's or Spearman's correlation to assess relationships between GPR56 expression and:

    • Treatment response metrics

    • Behavioral outcomes

    • Clinical variables

  • Multiple regression to model predictive relationships

  • Mediation analysis to test mechanistic hypotheses

• Advanced Statistical Methods:

  • Principal component analysis to reduce dimensionality in multi-parameter studies

  • Cluster analysis to identify response patterns

  • Machine learning approaches for predictive modeling

  • Bayesian statistics when incorporating prior knowledge

• Power Analysis and Sample Size Considerations:

  • Conduct a priori power analyses to determine adequate sample sizes

  • Report effect sizes (Cohen's d, η², etc.) alongside p-values

  • Consider false discovery rate correction for multiple comparisons

  • Calculate confidence intervals to indicate precision

When analyzing qRT-PCR data specifically, researchers should follow established guidelines for qPCR data analysis, including proper normalization to reference genes (e.g., GAPDH or CRYL1) . All statistical analyses should be conducted using validated software packages, and complete methodological details should be reported to ensure reproducibility.

How can researchers address data variability challenges in GPR56 studies using Macaca mulatta samples?

Managing data variability in GPR56 studies with Macaca mulatta samples requires comprehensive methodological strategies across experimental design, execution, and analysis phases:

• Biological Variability Management:

  • Account for age, sex, and genetic background in subject selection

  • Consider the impact of social hierarchy status on stress responses that may affect GPR56 expression

  • Standardize housing and environmental conditions

  • Account for diurnal variations by consistent sampling timing

  • Control for health status through comprehensive screening

• Technical Variability Reduction:

  • Standardize tissue collection and processing protocols

  • Implement rigorous quality control for RNA extraction (RIN values >8)

  • Perform technical replicates (minimum triplicates) for all qRT-PCR assays

  • Calibrate equipment regularly and use the same instrumentation throughout studies

  • Process all samples from comparative groups in parallel to minimize batch effects

• Normalization Strategies:

  • Employ multiple validated reference genes (e.g., GAPDH, CRYL1) for qRT-PCR normalization

  • Verify reference gene stability across experimental conditions

  • Consider global normalization approaches for high-throughput analyses

  • Include inter-run calibrators for studies requiring multiple PCR plates

• Statistical Approaches for Variability:

  • Apply variance-stabilizing transformations when appropriate

  • Use statistical models that account for known sources of variation

  • Employ mixed-effects models to handle nested data structures

  • Consider non-parametric approaches for data with persistent heterogeneity

• Reporting and Transparency:

  • Document all sources of variability in methodological descriptions

  • Report both central tendency and dispersion measures

  • Include individual data points in graphical presentations

  • Provide detailed protocols to enhance reproducibility

Researchers should also consider the unique characteristics of rhesus macaques as research subjects, including their complex social structures and behavioral repertoire . These factors can introduce additional variability that must be accounted for in experimental design and data interpretation.

What are the key challenges in translating GPR56 findings from Macaca mulatta models to human clinical applications?

Translating GPR56 research findings from Macaca mulatta models to human clinical applications faces several methodological challenges that researchers must address systematically:

• Species-Specific Receptor Differences:

  • Despite high conservation, subtle structural variations exist between macaque and human GPR56

  • These differences may affect:

    • Ligand binding properties

    • Signaling pathway coupling efficiency

    • Protein-protein interaction networks

    • Pharmacological response profiles

• Neuroanatomical and Physiological Considerations:

  • While rhesus macaques share significant neuroanatomical similarities with humans , important differences exist in:

    • Receptor distribution patterns across brain regions

    • Neurocircuitry organization and connectivity

    • Neurochemical environment differences

    • Developmental trajectories of receptor expression

• Methodological Translation Barriers:

  • Techniques developed for macaque models require adaptation for human application:

    • Invasive sampling methods must be replaced with non-invasive alternatives

    • Dosing regimens need adjustment for differences in metabolism and body size

    • Behavioral assessments require species-appropriate modifications

    • Biomarker validation across species is essential

• Regulatory and Ethical Considerations:

  • Human studies face stricter regulatory requirements than macaque research

  • Safety profiles established in macaques require extensive validation before human trials

  • Target engagement confirmation becomes more challenging in human subjects

  • Ethical limitations restrict certain experimental approaches possible in macaque models

• Data Integration Challenges:

  • Reconciling findings across species requires sophisticated bioinformatic approaches

  • Predictive algorithms for human responses based on macaque data need validation

  • Translational biomarkers must demonstrate cross-species reliability

  • Individual variation may be greater in human populations than controlled macaque cohorts

Despite these challenges, the rhesus macaque model offers significant translational advantages due to its close evolutionary relationship to humans . Researchers can enhance translational validity by employing parallel methodologies across species, focusing on conserved mechanisms, and developing cross-species validation approaches for critical findings.

How might GPR56 research in Macaca mulatta inform potential therapeutic applications for neuropsychiatric disorders?

GPR56 research in Macaca mulatta provides valuable insights that can inform therapeutic development for neuropsychiatric disorders through several methodological pathways:

• Target Validation Strategies:

  • Knockdown studies in macaque models can confirm causal relationships between GPR56 function and disease-relevant phenotypes

  • Region-specific manipulations help identify optimal intervention sites

  • Temporal manipulation studies reveal critical developmental windows for intervention

  • Cross-validation with human genetic and postmortem studies strengthens therapeutic rationale

• Therapeutic Modality Development:

  • Agonist studies with peptides like P7 and P19 establish proof-of-concept for GPR56 activation as a therapeutic approach

  • Structure-activity relationship studies can optimize lead compounds

  • Delivery method development (e.g., infusion parameters, carrier systems) in macaques helps overcome blood-brain barrier challenges

  • Safety and efficacy profiles in macaques provide essential pre-human data

• Biomarker Identification:

  • Expression patterns of GPR56 across tissues may serve as:

    • Diagnostic indicators for certain conditions

    • Predictive markers of treatment response

    • Pharmacodynamic markers of target engagement

  • Correlation of GPR56 expression with treatment outcomes enables patient stratification strategies

• Dosing and Administration Guidance:

  • Concentration-effect relationships established in macaques inform human dosing

  • Regional brain infusion studies identify optimal delivery parameters

  • Time course studies determine:

    • Onset of therapeutic effects

    • Duration of action

    • Development of tolerance

    • Withdrawal effects

• Combination Therapy Rationale:

  • Investigation of interactions between GPR56 modulators and conventional treatments

  • Identification of synergistic combinations

  • Development of sequential treatment protocols

  • Prediction of potential drug-drug interactions

The finding that GPR56 knockdown in mouse prefrontal cortex is associated with depressive-like behaviors and poor antidepressant response provides particular impetus for investigating GPR56-targeted approaches for treatment-resistant depression. Macaque models allow validation of these findings in a primate system with greater translational relevance to human neuropsychiatric conditions.