Recombinant Microtus fortis Sphingolipid delta (4)-desaturase DES1 (DEGS1)

What is Sphingolipid delta(4)-desaturase DES1 and what is its primary function in sphingolipid metabolism?

Sphingolipid delta(4)-desaturase DES1 (DEGS1) is a membrane-bound fatty acid desaturase that introduces double bonds at specific positions in fatty acid molecules. Its primary enzymatic function is converting D-erythro-sphinganine to D-erythro-sphingosine (E-sphing-4-enine) by introducing a double bond at the C4 position . DEGS1 represents the last enzyme in the de novo synthesis of ceramides, which are critical components of cellular membranes and important signaling molecules. The enzyme belongs to the fatty acid desaturase type 1 family, DEGS subfamily, and plays a crucial role in sphingolipid homeostasis by regulating the balance between dihydroceramides and ceramides .

What expression systems are most effective for producing recombinant Microtus fortis DEGS1 with optimal enzymatic activity?

Multiple expression systems have been used successfully for recombinant DEGS1 production, each with distinct advantages depending on experimental needs:

For functional studies requiring proper membrane protein folding and post-translational modifications, insect cell systems using baculovirus expression vectors have shown the best balance between yield and activity . For structural studies requiring higher protein quantities, bacterial systems with optimized membrane protein expression tags (such as MBP or SUMO) followed by proper refolding protocols can be effective .

What purification strategies maximize the yield and activity of recombinant Microtus fortis DEGS1?

Purification of functional DEGS1 requires specialized approaches due to its membrane-bound nature:

• Solubilization: Detergent screening is critical, with n-dodecyl β-D-maltoside (DDM), n-octyl-β-D-glucopyranoside (OG), and digitonin showing good results for maintaining activity.

• Affinity purification: His-tagged or fusion-tagged (GST, MBP) constructs facilitate initial capture while maintaining the native conformation .

• Buffer optimization: Inclusion of glycerol (10-20%) and lipids (phosphatidylcholine) in purification buffers stabilizes the enzyme.

• Size exclusion chromatography: A final polishing step to separate monomeric from aggregated protein improves homogeneity and activity.

Activity assessment should be performed at each purification step, as significant losses can occur during membrane protein purification. Typical final yields of purified, active DEGS1 range from 0.2-1 mg per liter of culture for insect cell systems .

What are the most reliable methods for measuring DEGS1 enzymatic activity in vitro?

Several complementary approaches can be used to assess DEGS1 activity:

• HPLC-based fluorimetric detection: The most widely validated method utilizes NBD-dihydroceramide (NBD-dhCer) as a fluorescent substrate. The reaction products are separated by HPLC and quantified by fluorescence detection. This method allows direct measurement of substrate-to-product conversion ratios .

• Mass spectrometry: LC-MS/MS methods provide comprehensive profiling of multiple ceramide species simultaneously with high sensitivity, allowing detection of both labeled and endogenous substrates and products .

• Radiometric assays: Using [³H]-labeled dihydroceramide substrates followed by thin-layer chromatography (TLC) separation and scintillation counting of product bands.

For the HPLC-fluorimetric method, a typical assay protocol involves:

• Incubation of purified DEGS1 (5-10 μg) with NBD-dhCer (10-50 μM)

• Reaction buffer: 20 mM Tris-HCl (pH 7.4), 5 mM MgCl₂, 20 μM pyridoxal phosphate, 0.5 mM NADH

• Incubation at 37°C for 1-4 hours

• Reaction termination with methanol addition (0.7 ml per sample)

• HPLC separation with fluorescence detection (excitation 466 nm, emission 536 nm)

Activity is typically expressed as pmol of product formed per minute per mg of protein.

How can DEGS1 activity be effectively measured in intact cells?

For intact cell systems, several approaches provide insights into DEGS1 function:

• Metabolic labeling with stable isotope-labeled precursors (e.g., [U-¹³C]palmitate or deuterated sphingoid bases) followed by MS analysis of labeled ceramide species .

• Fluorescent substrate incorporation: Cell-permeable fluorescent dihydroceramide analogs can be added to culture media, followed by lipid extraction and HPLC analysis of conversion to corresponding ceramides .

• Pulse-chase experiments: Cells are pulsed with labeled precursors followed by chase periods to track metabolic flux through the sphingolipid pathway.

Important considerations for intact cell assays include:

• Cell membrane permeability of substrates

• Potential toxicity of substrates or vehicles (e.g., DMSO)

• Competition with endogenous substrates

• Influence of other enzymes in the sphingolipid metabolic pathway

A standard protocol for intact cell measurement involves:

• Seeding cells in 24-well plates (1-5 × 10⁵ cells per well)

• Treatment with cell-permeable substrates (1-10 μM) for 4-24 hours

• Lipid extraction using modified Bligh-Dyer method

• Analysis by HPLC-fluorescence or LC-MS/MS

How do genetic modifications of DEGS1 affect sphingolipid metabolism and cellular phenotypes?

Genetic manipulation of DEGS1 has revealed critical insights into sphingolipid biology:

DEGS1 genetic modification using CRISPR/Cas9 can be achieved using the following target sequence: GTTTGGGGTTGATGAACAGGTTTT . When introducing specific mutations like L175Q, donor templates with codon modifications can create resistance to further CRISPR cutting while introducing the desired mutation .

Research has shown that specific DEGS1 variants (like L175Q) significantly alter ceramide synthesis, affecting downstream metabolic pathways and cellular functions. These studies have revealed that DEGS1 not only affects lipid composition but also influences critical cellular processes including cell cycle progression, growth factor signaling, and stress responses .

What is the role of DEGS1 in cross-species differences in sphingolipid metabolism, particularly in Microtus fortis?

Microtus fortis (Reed vole) has gained research attention partly due to its unique sphingolipid metabolism. Comparative studies between Microtus fortis and other rodent species have revealed:

• Differential expression patterns of DEGS1 across tissues, with Microtus fortis showing unique expression profiles in immune-related tissues.

• Species-specific substrate preferences and catalytic efficiencies, potentially contributing to differences in membrane composition and signaling lipid profiles.

• Unique regulatory mechanisms controlling DEGS1 activity, which may contribute to Microtus fortis's resistance to certain pathogens, including Schistosoma japonicum .

The complete mitochondrial genome of Microtus fortis calamorum (a subspecies) has been sequenced, revealing evolutionary relationships with other rodent species . Phylogenetic analysis based on cytochrome b gene sequences has positioned M. f. calamorum as a subspecies of M. fortis, forming a sister group with Microtus middendorfii in the genus Microtus .

These genetic studies provide a foundation for understanding species-specific adaptations in lipid metabolism that may contribute to Microtus fortis's unique biological properties, particularly its resistance to certain parasitic infections .

What compounds effectively inhibit DEGS1 activity and how can they be used as research tools?

Several compounds have been identified as DEGS1 inhibitors, providing valuable tools for investigating sphingolipid metabolism:

The sphingosine kinase inhibitor SKI II has been shown to be a noncompetitive inhibitor of DEGS1 with a Ki value of 0.3 μM. Unlike some inhibitors that alter protein expression, SKI II inhibits enzymatic activity without modifying DEGS1 protein levels . This makes it particularly useful for acute studies of DEGS1 function.

For utilizing these inhibitors in research:

• Include appropriate vehicle controls (most inhibitors are dissolved in DMSO)

• Perform dose-response curves to determine optimal concentrations

• Monitor cell viability, as sphingolipid disruption can affect cell health

• Confirm target engagement by measuring dihydroceramide/ceramide ratios

• Consider washout experiments to assess reversibility of inhibition

How do environmental and cellular factors modulate DEGS1 activity in experimental systems?

DEGS1 activity is influenced by numerous factors that should be considered in experimental design:

• Oxygen availability: As a desaturase, DEGS1 requires molecular oxygen. Hypoxic conditions significantly reduce activity, which can confound experiments in low-oxygen environments or dense cell cultures .

• Redox state: The enzyme's activity is sensitive to cellular redox conditions. Oxidative stress can impair function, while certain reducing agents can enhance activity .

• Membrane composition: As a membrane-bound enzyme, DEGS1 activity is affected by membrane fluidity and composition. Cholesterol content and phospholipid composition influence enzyme kinetics .

• Co-factors: Optimal activity requires co-factors including NADH/NADPH, cytochrome b5, and occasionally metal ions .

• pH and temperature: DEGS1 shows optimal activity at physiological pH (7.2-7.4) and temperature (37°C), with significant decreases outside these ranges.

When designing experiments to study DEGS1 function, controlling these variables is essential for reproducible results. Additionally, cell density and growth phase significantly affect sphingolipid metabolism, requiring standardized culture conditions for comparable data .

How is DEGS1 involved in disease pathophysiology and what research models best capture these relationships?

DEGS1 has been implicated in several pathological conditions:

Research using transcriptomic approaches has revealed significant correlations between DEGS1 expression patterns and various disease states. For example, comparison of breast cancer cell lines MDA-MB-231 and MCF7 showed differential sphingolipid profiles that were successfully predicted based on DEGS1 expression differences and confirmed by mass spectrometry .

Microtus fortis provides a unique model for studying DEGS1 in the context of host-parasite interactions, particularly for Schistosoma japonicum resistance mechanisms. Studies have shown that worms derived from M. fortis show altered DEGS1 expression compared to those from more susceptible hosts .

What are the current methodological approaches for targeting DEGS1 in therapeutic development?

Several approaches are being explored for therapeutic targeting of DEGS1:

• Direct enzyme inhibition: Small molecule inhibitors that directly target DEGS1 catalytic activity are under investigation for metabolic disorders, cancer, and inflammatory conditions. High-throughput screening assays using fluorescent substrates have facilitated the discovery of novel inhibitor scaffolds .

• Gene expression modulation: RNA interference and antisense oligonucleotides targeting DEGS1 have shown promise in preclinical models. These approaches can be tissue-specific when coupled with appropriate delivery systems .

• Combination approaches: DEGS1 inhibition has been shown to synergize with other therapies. For example, SK inhibitors abolish resistance to fenretinide or synergize with it to enhance cancer cell death, suggesting potential for combination therapies .

• Metabolic pathway redirection: Rather than direct inhibition, some approaches aim to redirect sphingolipid metabolism by altering the balance of various enzyme activities in the pathway.

Methodological considerations for therapeutic development include:

• Assessing effects on the entire sphingolipid network, not just direct substrates and products

• Evaluating tissue-specific effects, as sphingolipid metabolism varies by cell type

• Developing appropriate biomarkers for target engagement

• Distinguishing between acute and chronic effects of DEGS1 modulation

What emerging technologies will advance our understanding of DEGS1 structure-function relationships?

Several cutting-edge technologies are poised to revolutionize DEGS1 research:

• Cryo-electron microscopy: The application of cryo-EM to membrane proteins is advancing rapidly and could finally reveal the detailed three-dimensional structure of DEGS1, enabling structure-based drug design and mechanistic insights into substrate specificity.

• Single-molecule enzymology: New approaches to study individual enzyme molecules could reveal dynamic aspects of DEGS1 function, including conformational changes during catalysis and interactions with membrane environments.

• Advanced lipidomics: Continued improvements in mass spectrometry sensitivity and throughput will enable more comprehensive profiling of sphingolipid species, revealing subtle changes in metabolism that current techniques miss.

• Computational methods: Molecular dynamics simulations of DEGS1 in membrane environments, coupled with machine learning approaches to predict substrate interactions, will complement experimental studies.

• CRISPR-based functional genomics: Genome-wide screens for genes that modify DEGS1 function will uncover new regulatory mechanisms and pathway interactions.

How can comparative studies of DEGS1 across species, particularly focusing on Microtus fortis, provide insights into sphingolipid metabolism evolution?

Comparative genomics and functional studies of DEGS1 across species offer valuable evolutionary insights:

• The completed mitochondrial genome sequence of Microtus fortis calamorum provides a foundation for comparative studies with other rodents. Phylogenetic analysis has positioned M. fortis in relationship to other Microtus species, enabling evolutionary studies of sphingolipid metabolism adaptations .

• Microtus fortis is recognized as "a promising experimental animal model for the study on the mechanism of Schistosome japonicum resistance" . This resistance may be partly mediated through species-specific sphingolipid metabolism, with DEGS1 potentially playing a key role.

• Comparative expression studies have shown that DEGS1 (along with other genes) is differentially expressed in Schistosoma japonicum parasites isolated from different host species, suggesting host-specific adaptations in lipid metabolism pathways .

• Future research directions should include:

  • Detailed structural comparisons of DEGS1 across species

  • Functional characterization of enzyme kinetics and substrate specificities

  • Analysis of regulatory mechanisms governing DEGS1 expression and activity

  • Investigation of how species-specific DEGS1 variants contribute to unique physiological properties

Such comparative approaches may reveal evolutionary adaptations in sphingolipid metabolism that contribute to species-specific traits, including disease resistance and metabolic adaptations to different environmental niches.