Recombinant Mitochondrial import inner membrane translocase subunit TIM50 (scpl-4)

What is the structural organization of TIM50 and how does it relate to its function?

TIM50 spans the inner mitochondrial membrane with a single transmembrane segment and exposes a large hydrophilic domain in the intermembrane space (IMS) . This structural arrangement is critical for its function as it allows TIM50 to interact with both the translocase of the outer membrane (TOM) complex and other components of the TIM23 complex . The protein contains distinct domains that coordinate together during the translocation process of proteins into mitochondria . Specifically, the large hydrophilic domain in the intermembrane space enables TIM50 to recognize and bind presequences of incoming precursor proteins, facilitating their transfer from the TOM to TIM23 complex .

How does TIM50 facilitate protein transport across mitochondrial membranes?

TIM50 plays a crucial role in the transfer of precursor proteins from the TOM complex to the TIM23 complex through the intermembrane space . Cross-linking experiments have demonstrated that TIM50 is positioned in close proximity to the intermembrane space side of the TOM complex where it recognizes both matrix-targeted proteins and inner membrane proteins . TIM50 has been shown to recognize presequences of incoming precursor proteins, including matrix proteins like pFb2 and Jac1, as well as inner membrane proteins such as Oxa1 and Rieske FeS protein . This recognition occurs even when precursors are halted at the level of the TOM complex in the absence of membrane potential, indicating that TIM50 functions early in the import pathway . The interaction between TIM50 and Tim23 is essential for this transfer process, as the efficient movement of precursors between TOM and TIM23 complexes requires the concerted action of both proteins .

What experimental models are available for studying TIM50 function?

Several experimental models have been developed to study TIM50 function across different organisms. These include:

• Yeast models: Initial studies utilized yeast systems to demonstrate that Tim50 is essential for viability, with depletion experiments showing deficiencies in protein import via the TIM23 pathway .

• Mouse models: Both global TIM50 knockout mice and cardiac-specific TIM50 transgenic mice have been generated to study TIM50's role in cardiac hypertrophy . The global knockout was created using CRISPR-Cas9 technology, while cardiac-specific overexpression was achieved through a pCAG-loxP-CAT-loxP-TIM50-polyA construct crossed with appropriate cardiac-specific promoter mice .

• Cell culture systems: Neonatal rat cardiomyocytes with gain or loss of function of TIM50 have been used to study its role in cardiac hypertrophy at the cellular level .

• Recombinant protein systems: Full-length recombinant TIM50 proteins from various species, including Caenorhabditis briggsae, are available for in vitro studies .

These diverse models provide complementary approaches to understanding TIM50 function across evolutionary scales and in different physiological contexts.

How does TIM50 regulate oxidative stress in cardiac tissue?

TIM50 functions as a novel protective regulator in cardiac hypertrophy primarily by attenuating oxidative stress . Research using both loss-of-function and gain-of-function models has demonstrated that TIM50 regulates reactive oxygen species (ROS) generation and the activities of antioxidant enzymes . Specifically, TIM50 deficiency leads to increased oxidative stress in cardiac tissue, while overexpression reduces ROS accumulation .

The mechanism involves regulation of multiple antioxidant systems:

Importantly, treatment with the antioxidant N-acetyl cysteine (NAC) reversed the hypertrophic and fibrotic phenotypes caused by TIM50 deficiency, confirming that TIM50's cardioprotective effects are primarily mediated through oxidative stress reduction . This suggests that TIM50 inhibits the activity of apoptosis signal-regulating kinase 1 (ASK1) during pathological cardiac hypertrophy by attenuating oxidative stress .

What is known about the interaction between TIM50 and the TIM23 complex?

TIM50 is recruited to the TIM23 complex primarily through its interaction with Tim23, and this association is essentially independent of the rest of the translocase . Biochemical and genetic experiments have identified distinct roles for the two domains of Tim50 in the intermembrane space during protein translocation . The core domain of TIM50 is primarily responsible for its recruitment to the TIM23 complex, as demonstrated through coimmunoprecipitation experiments .

Research using "50split cells" (where the two individually expressed segments of Tim50 are present) has provided insights into how different domains contribute to TIM50 function . These studies suggest that the C-terminal domain is particularly important for presequence recognition, while the core domain mediates association with the TIM23 complex.

The TIM50-TIM23 interaction creates a functional unit that positions TIM50 optimally to receive incoming precursor proteins from the TOM complex and direct them to the TIM23 channel . This spatial arrangement is crucial for the efficient transfer of precursors across the intermembrane space.

How is TIM50 expression regulated in pathological conditions?

TIM50 expression is downregulated in both human dilated cardiomyopathy (DCM) hearts and hypertrophic murine hearts . This altered expression appears to contribute to the pathogenesis of cardiac hypertrophy. Experiments comparing TIM50 levels between healthy and diseased cardiac tissue have provided insights into how TIM50 regulation may be dysregulated during pathological processes .

The mechanisms controlling TIM50 expression are not fully characterized, but the documented changes in expression under pathological conditions suggest that TIM50 is subject to regulatory pathways that respond to cellular stress. Given its role in mitochondrial function and oxidative stress management, the downregulation of TIM50 during cardiac hypertrophy may represent a maladaptive response that exacerbates pathology by reducing the heart's ability to manage increased metabolic demands and oxidative stress .

What are the optimal methods for working with recombinant TIM50 protein?

When working with recombinant TIM50 protein, several methodological considerations are important for optimal results:

• Storage and handling: Recombinant TIM50 protein should be stored at -20°C/-80°C upon receipt, with aliquoting necessary for multiple use to avoid repeated freeze-thaw cycles, which can degrade the protein . Working aliquots can be stored at 4°C for up to one week .

• Reconstitution: Prior to opening, vials should be briefly centrifuged to bring contents to the bottom. The lyophilized protein should be reconstituted in deionized sterile water to a concentration of 0.1-1.0 mg/mL . Adding glycerol to a final concentration of 5-50% (with 50% being standard) is recommended for long-term storage .

• Buffer conditions: Tris/PBS-based buffer with 6% Trehalose at pH 8.0 is typically used as a storage buffer for recombinant TIM50 .

• Quality control: Purity should be greater than 90% as determined by SDS-PAGE before proceeding with experiments .

• Experimental applications: For functional studies, recombinant TIM50 has been used in protein-protein interaction assays, cross-linking experiments, and reconstitution into liposomes to study its role in protein translocation .

How can researchers generate and validate TIM50-deficient experimental models?

Generating TIM50-deficient models requires careful consideration due to TIM50's essential role in cellular viability. Several approaches have been validated:

• CRISPR-Cas9 gene editing: Global TIM50 knockout mice have been successfully generated using CRISPR-Cas9 technology . This approach involved:

  • Using online CRISPR design tools to predict guide sequences targeting the mouse TIM50 gene

  • Annealing oligomers (oligo1: TAGGCCTTGGAGCCCCCACGGT and oligo2: AAACACCGTGGGGGCTCCAAGG) and cloning them into sgRNA expression vectors

  • Transcribing sgRNA and Cas9 using appropriate kits

  • Microinjecting Cas9 and sgRNA mRNA into single-cell embryos

• Conditional knockouts: For tissue-specific studies, conditional knockout approaches are preferred, especially given TIM50's essential nature. For cardiac-specific studies, a pCAG-loxP-CAT-loxP-TIM50-polyA construct crossed with cardiac-specific Cre-expressing mice has been effective .

• Verification methods: Successful TIM50 depletion should be verified through:

  • PCR analysis using appropriate primers

  • Western blot analysis to confirm reduced protein expression

  • Functional assays to validate mitochondrial import defects

  • Assessment of oxidative stress parameters as functional readouts

• Phenotypic characterization: In cardiac models, echocardiography, histological analysis, Western blot, and real-time PCR have been used to assess the effects of TIM50 deficiency on cardiac structure and function .

What assays can measure TIM50's role in protein translocation?

Several experimental approaches have been developed to assess TIM50's function in protein translocation:

• In vitro import assays: Using isolated mitochondria from TIM50-depleted cells and radiolabeled precursor proteins to measure import kinetics of TIM23 substrates . This approach has demonstrated that mitochondria from cells depleted of TIM50 show strongly reduced import kinetics of preproteins using the TIM23 complex .

• Cross-linking experiments: Chemical cross-linking followed by immunoprecipitation has been used to detect interactions between TIM50 and precursor proteins. This method has shown that TIM50 can be cross-linked to preproteins halted at the TOM complex or spanning both TOM and TIM23 complexes .

• Precursor chase experiments: After establishing cross-linking to TIM50, reestablishing membrane potential allows precursors to be chased into mitochondria with concomitant loss of cross-linking adducts to TIM50, demonstrating that TIM50-bound species are productive import intermediates .

• Preprotein recognition assays: Various precursor proteins including matrix proteins (pFb2, Jac1) and inner membrane proteins (Oxa1, Rieske FeS protein) have been used to demonstrate TIM50's ability to recognize different classes of mitochondrial preproteins .

• Co-immunoprecipitation: This technique has been valuable for investigating how TIM50 is recruited to the TIM23 complex and for studying interactions between different domains of TIM50 and other translocase components .

How might contradictory findings about TIM50 function be reconciled across different experimental systems?

Researchers studying TIM50 across different experimental systems may encounter seemingly contradictory results due to several factors:

• Species-specific differences: TIM50 has been studied in yeast, C. briggsae, mice, and human samples, with potential functional divergence across species . When comparing results across species, researchers should consider evolutionary changes in protein sequence, interaction partners, and regulatory mechanisms.

• Context-dependent functions: TIM50 appears to have dual roles in both protein import and regulation of oxidative stress . The relative importance of these functions may vary across tissue types and physiological states. Researchers should carefully control for cellular context when designing experiments and interpreting results.

• Technical variations: Different methodologies for protein depletion, overexpression, or functional assessment may yield varying results. Standardized protocols and multiple complementary approaches should be used to validate findings.

• Reconciliation strategies:

  • Perform comparative studies using the same methodologies across different model systems

  • Utilize domain-specific mutants to distinguish between different functions of TIM50

  • Employ systems biology approaches to model the complex network of TIM50 interactions

  • Consider post-translational modifications that might regulate TIM50 function differently across systems

What are the technical challenges in studying TIM50's dynamic interactions during protein translocation?

Studying the dynamic interactions of TIM50 during protein translocation presents several technical challenges:

• Temporal resolution: Protein translocation occurs rapidly, making it difficult to capture transient interactions between TIM50 and precursor proteins. Advanced time-resolved techniques such as stopped-flow spectroscopy or rapid mixing devices coupled with cross-linking may be needed.

• Spatial resolution: TIM50 functions at the interface between the TOM and TIM23 complexes in a spatially restricted environment. Super-resolution microscopy or cryo-electron tomography may help visualize these interactions in their native context.

• Conformational changes: TIM50 likely undergoes conformational changes during the recognition and transfer of precursor proteins. Techniques like hydrogen-deuterium exchange mass spectrometry or single-molecule FRET could help capture these structural dynamics.

• Complex formation: TIM50 functions within the context of larger protein complexes. Blue native PAGE, chemical cross-linking coupled with mass spectrometry, or proximity labeling approaches can help map these complex interaction networks.

• Reconstitution systems: Fully recapitulating the membrane environment and protein complexes in vitro is challenging. Advanced liposome or nanodisc systems incorporating both TOM and TIM complexes would be valuable for mechanistic studies.

How can researchers best investigate the therapeutic potential of TIM50 for cardiac diseases?

Based on TIM50's protective role in cardiac hypertrophy through regulation of oxidative stress, several approaches could be employed to investigate its therapeutic potential:

• Target validation strategies:

  • Pharmacological rescue experiments: As demonstrated with N-acetyl cysteine, which reversed the effects of TIM50 deficiency, researchers could test whether targeting downstream pathways can compensate for TIM50 dysfunction .

  • Genetic rescue experiments: Tissue-specific overexpression of TIM50 or its functional domains could validate whether increasing TIM50 activity is sufficient to prevent or reverse cardiac pathology.

  • Patient stratification: Analyzing TIM50 expression levels in human heart failure samples might identify patient subgroups most likely to benefit from TIM50-targeted therapies.

• Therapeutic development approaches:

  • Small molecule screening: Identify compounds that increase TIM50 expression or enhance its activity using cell-based reporter assays.

  • Gene therapy vectors: Develop cardiotropic viral vectors expressing TIM50 for localized delivery to the heart.

  • Structure-based drug design: Using the known structure of TIM50 domains to design peptide mimetics that could enhance its function.

• Assessment methods for evaluating efficacy:

  • Oxidative stress biomarkers: Measure ROS levels, antioxidant enzyme activities, and oxidative damage markers.

  • Mitochondrial function parameters: Assess respiratory chain complex activities and mitochondrial membrane potential.

  • Cardiac remodeling indicators: Evaluate hypertrophy, fibrosis, and cardiac function using echocardiography and histological analysis.

  • ASK1-JNK/P38 pathway activation: Monitor the status of this signaling pathway as a mechanistic readout of TIM50 activity .