Recombinant Mouse C-X-C motif chemokine 9 protein (Cxcl9), partial (Active)

What is the structural composition of Recombinant Mouse CXCL9 protein?

Recombinant Mouse CXCL9 (also known as MIG - Monokine Induced by Gamma-interferon) is typically produced using E. coli expression systems. The recombinant protein corresponds to the amino acid sequence Thr22-Thr126 of the native mouse CXCL9 protein . This partial active form maintains the functional domains necessary for receptor binding and biological activity while excluding the signal peptide region. The protein's secondary structure includes conserved CXC motifs characteristic of this chemokine family, which are critical for receptor recognition and downstream signaling events.

How does CXCL9 function in the immune system?

CXCL9 functions primarily as a chemoattractant for immune cells expressing the CXCR3 receptor. In experimental settings, CXCL9 demonstrates a dose-dependent ability to chemoattract BaF3 mouse pro-B cells transfected with mouse CXCR3, with an ED50 of approximately 0.1-0.5 μg/mL . This chemotactic function is central to immune cell recruitment during inflammatory responses. CXCL9 works cooperatively with related chemokines CXCL10 and CXCL11, which also bind to CXCR3 but with different affinities - CXCL11 binds with highest affinity, followed by CXCL10 and then CXCL9 . These differential binding properties allow for fine-tuned regulation of immune cell trafficking and activation.

What are the optimal conditions for using Recombinant Mouse CXCL9 in chemotaxis assays?

For chemotaxis assays using Recombinant Mouse CXCL9, researchers should consider the following methodological approach:

• Cell preparation: Use CXCR3-expressing cells such as BaF3 mouse pro-B cell lines transfected with mouse CXCR3

• Dose range: Prepare a concentration gradient starting from 0.01-5 μg/mL, with particular focus on the 0.1-0.5 μg/mL range where ED50 typically occurs

• Migration chambers: Use Transwell® or Boyden chamber systems with appropriate pore sizes (5-8 μm)

• Incubation time: Optimal migration typically occurs within 2-4 hours at 37°C

• Quantification methods: Employ Resazurin-based quantification (as demonstrated in the literature) or alternative cell counting methods such as flow cytometry

For neutralization studies, pre-incubate CXCL9 with anti-CXCL9 antibodies (starting at concentrations of 6-20 μg/mL which typically achieve ND50) before adding to the chemotaxis assay .

How should CXCL9 expression be measured in tissue samples?

Multiple methodologies are appropriate for measuring CXCL9 expression in tissue samples:

For optimal results in tissue analysis, in situ hybridization of Cxcl9 mRNA combined with immunostaining for tissue-specific markers (such as Runx2 for osteoblasts) provides valuable spatial context for expression patterns .

How does CXCL9 signaling interact with other cytokine networks?

CXCL9 signaling operates within a complex network of cytokine interactions. Research indicates that CXCL9 production is heavily dependent on IFNγ signaling, forming a critical feedback loop in immune responses . In experimental models:

• IFNγ-dependent induction: Blockade of IFNγ significantly reduces CXCL9 production following therapeutic interventions such as immune checkpoint inhibition

• Regulatory pathways: The mTORC1 pathway has been identified as a key regulator of Cxcl9 expression in osteoblasts, demonstrating that metabolic signaling pathways can influence chemokine production

• Coordinate expression: CXCL9 expression often correlates with related chemokines like CXCL10, suggesting coordinated regulation of these chemokines

When designing experiments to study CXCL9 signaling networks, researchers should consider incorporating multiple cytokine measurements through multiplex assays such as cytometric bead arrays, which allow for simultaneous quantification of CXCL9 alongside other relevant cytokines and chemokines .

What is the role of CXCL9 in tumor microenvironment modulation?

CXCL9 plays a multifaceted role in tumor microenvironment modulation:

• Immune cell recruitment: CXCL9 and CXCL10 are significantly upregulated in tumor microenvironments following dual PD-1/CTLA-4 blockade therapy, suggesting a crucial role in mediating therapeutic responses to immune checkpoint inhibitors

• Source identification: Studies using CRISPR-Cas9 knockout approaches have demonstrated that tumor cell-derived CXCL9 may be less critical than macrophage-derived CXCL9 in certain contexts, highlighting the importance of cellular source in determining functional outcomes

• Prognostic implications: High transcriptional levels of CXCL9, along with CXCL10, CXCL12, and CXCL13, are associated with better prognosis in breast cancer patients, suggesting a favorable impact on anti-tumor immunity

• Immune cell infiltration: CXCL9 expression strongly correlates with infiltration of multiple immune cell types, including B cells, CD8+ T cells, CD4+ T cells, macrophages, neutrophils, and dendritic cells in the tumor microenvironment

How does CXCL9 expression correlate with cancer prognosis and treatment response?

Analysis of CXCL9 expression in clinical samples reveals significant correlations with both prognosis and treatment response:

• Prognostic value: High transcriptional expression of CXCL9 is associated with improved survival outcomes in breast cancer patients

• Correlation with clinical parameters: CXCL9 expression significantly correlates with known prognostic factors, including patient age, cancer subtype, individual cancer stages, and nodal metastasis status

• Treatment response biomarker: Upregulation of CXCL9 in the tumor microenvironment following dual PD-1/CTLA-4 blockade has been identified as a potential biomarker for response to immunotherapy

• Therapeutic mechanism: Neutralization of CXCR3 (the receptor for CXCL9 and CXCL10) abrogates the therapeutic efficacy of dual PD-1/CTLA-4 blockade, demonstrating the mechanistic importance of this signaling axis in immunotherapy effectiveness

These findings suggest that measurement of CXCL9 expression and its associated pathways may provide valuable prognostic and predictive information in cancer treatment settings.

What are the differential effects of CXCL9 in various tissue microenvironments?

CXCL9 exhibits context-dependent functions across different tissue microenvironments:

• Bone marrow: Research has demonstrated that osteoblast-derived CXCL9 influences endothelial cell behavior through CXCR3 signaling. Quantitative analysis reveals measurable concentrations of CXCL9 in bone marrow (typically higher than in serum), indicating a potential role in regulating hematopoietic stem cell niche dynamics

• Tumor microenvironment: In tumors, CXCL9 predominantly functions to recruit and activate CD8+ T cells, improving anti-tumor immune responses. This effect is particularly pronounced following immunotherapy treatments

• Vascular system: CXCL9 interacts with CXCR3+ endothelial cells, potentially influencing angiogenesis in different contexts. Studies have documented expression of CXCR3 on CD31+ endothelial cells in bone marrow and on cultured HUVECs, suggesting direct effects on vascular cells

When investigating tissue-specific effects, researchers should employ techniques that preserve spatial context, such as immunohistochemistry combined with in situ hybridization, rather than relying solely on homogenized tissue measurements.

What are the optimal detection methods for CXCL9 in different experimental systems?

Selection of appropriate detection methods depends on experimental objectives and sample types:

For intracellular detection of CXCL9 by flow cytometry, cells should be cultured for approximately 3 hours in Golgi Plug/Stop without PMA/ionomycin stimulation to preserve physiological production levels .

What strategies can be employed for generating CXCL9 knockout models to study its function?

CRISPR-Cas9 gene editing provides an efficient approach for generating CXCL9 knockout models:

• sgRNA design: Based on published research, effective sgRNA sequences for mouse CXCL9 include: "auuuguaguggaucgugccu" and "aaccugccuagauccggacu"

• Delivery method: Electroporation of sgRNA/Cas9 RNPs using appropriate cell line kits (such as Lonza SG Cell line kit and 4D-Nucleofector) provides efficient delivery to target cells

• Validation approach: Knockout confirmation should be performed within 48 hours using Western immunoblot analysis

• Control considerations: Generate parallel knockouts of related chemokines (e.g., CXCL10) using sequences such as "ugacgggccagugagaauga" and "ugagcagagaugucugaauc" to distinguish specific functions

• Functional assessment: Evaluate phenotypes through chemotaxis assays, immune cell infiltration analyses, and in vivo tumor growth studies to comprehensively characterize CXCL9 function

When interpreting results from knockout models, researchers should consider potential compensatory mechanisms involving related chemokines, particularly CXCL10 and CXCL11, which share the CXCR3 receptor.

How might combinatorial approaches utilizing CXCL9 enhance cancer immunotherapy?

Current research suggests several promising directions for incorporating CXCL9-related strategies into cancer immunotherapy:

• Biomarker development: Monitoring CXCL9 expression levels before and during immunotherapy may help predict and monitor treatment response

• Targeted CXCL9 induction: Developing approaches to selectively enhance CXCL9 production within the tumor microenvironment could potentially improve T cell recruitment and activation

• Cell-specific targeting: Based on findings that macrophage-derived CXCL9 may be more critical than tumor cell-derived CXCL9 for therapeutic responses, strategies targeting specific cellular sources of CXCL9 might provide more precise immunomodulation

• Pathway modulation: Leveraging the discovered relationship between mTORC1 signaling and CXCL9 production could offer novel approaches to enhance anti-tumor immunity through metabolic pathway modulation

In designing such studies, measurement of multiple chemokines (particularly CXCL9, CXCL10, and CXCL11) and correlation with immune cell infiltrates will provide more comprehensive understanding of therapeutic mechanisms.

What are the emerging technologies for studying CXCL9 dynamics in living systems?

Several cutting-edge technologies are advancing our ability to study CXCL9 dynamics:

• Single-cell transcriptomics: Enables high-resolution analysis of cellular heterogeneity in CXCL9 production and response within complex tissues

• Spatial transcriptomics: Provides spatial context for CXCL9 expression patterns relative to other cell types and anatomical structures

• Intravital imaging: When combined with fluorescently labeled antibodies or reporter systems, allows visualization of CXCL9-mediated cell recruitment in real-time

• CRISPR screening: Facilitates identification of novel regulators and effectors in the CXCL9 signaling network

• Chemokine reporter systems: Development of biosensors that can detect active chemokine gradients would significantly advance understanding of CXCL9 function in vivo

Implementation of these technologies will provide deeper insights into the dynamic regulation and function of CXCL9 in various physiological and pathological contexts.