Recombinant Mouse Casein kinase I isoform gamma-2 (Csnk1g2)

What is Mouse Casein Kinase I Isoform Gamma-2 (Csnk1g2)?

Mouse Casein kinase I isoform gamma-2 (Csnk1g2) is a serine/threonine protein kinase belonging to the casein kinase family. These enzymes are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. Csnk1g2 can phosphorylate a wide range of protein targets and participates in various cellular signaling pathways, most notably Wnt signaling . The protein is encoded by the Csnk1g2 gene (Mouse GeneID: 103236) and is also known by several alternative names including CK Igamma2, CKI gamma2, and CKI-gamma-2 .

Structurally, Csnk1g2 contains a catalytic domain with a conserved lysine residue (K75) that is essential for its kinase activity. The protein also features regulatory phosphorylation sites, including serine 211 (S211) and threonine 215 (T215), which are important for modulating its enzymatic function . In mouse systems, Csnk1g2 is expressed in multiple tissues but has demonstrated particularly significant functions in testicular cells.

What cellular pathways involve Csnk1g2?

Csnk1g2 participates in several critical cellular signaling networks. Most prominently, it functions within the Wnt signaling pathway, which regulates crucial aspects of cell fate determination, migration, and proliferation during embryonic development and tissue homeostasis . Additionally, recent research has revealed that Csnk1g2 plays an important regulatory role in necroptosis, a form of programmed cell death .

In testicular tissue, Csnk1g2 appears to function as a suppressor of necroptosis. Knockout studies demonstrate that when Csnk1g2 is absent, there is enhanced activation of necroptosis in testis cells, as evidenced by increased phosphorylation of MLKL (Mixed Lineage Kinase Domain-Like Protein) at Serine 345 . This phosphorylation event is a key marker of necroptosis activation, indicating that Csnk1g2 normally acts to restrain this cell death pathway in testicular tissue.

The interaction between Csnk1g2 and the necroptosis machinery appears to be particularly relevant for age-related reproductive decline, suggesting that this kinase plays a protective role in maintaining testicular function throughout the aging process .

How is Csnk1g2 detected in experimental settings?

Researchers employ several complementary techniques to detect and measure Csnk1g2 in experimental systems:

• ELISA (Enzyme-Linked Immunosorbent Assay): Commercial ELISA kits are available for the quantitative measurement of mouse Csnk1g2 in tissue homogenates, cell lysates, and other biological fluids. These assays typically have a detection range of 0.156-10 ng/ml and utilize colorimetric detection methods .

• Western Blotting: This technique allows visualization of Csnk1g2 protein expression in tissue or cell extracts. It can also be used to detect post-translational modifications, such as phosphorylation events that regulate Csnk1g2 activity .

• Immunohistochemistry (Paraffin): This method enables researchers to visualize the spatial distribution of Csnk1g2 within tissue sections, providing insights into its localization patterns in different cell types .

• Immunofluorescence: Similar to immunohistochemistry, but utilizing fluorescent detection systems, this technique allows for high-resolution imaging of Csnk1g2 distribution in cells and tissues .

These detection methods typically employ specific antibodies, such as rabbit polyclonal antibodies, that recognize epitopes within the Csnk1g2 protein. The recommended antibody concentration for most applications is approximately 1 μg/mL .

What phenotypic changes occur in Csnk1g2 knockout mice?

Csnk1g2 knockout mice exhibit striking age-dependent phenotypic changes that primarily affect reproductive tissues and body composition. A detailed comparison between Csnk1g2 knockout mice and their wild-type littermates reveals:

At 2 months of age, Csnk1g2 knockout mice are indistinguishable from their wild-type littermates in terms of body weight, seminal vesicle size, testis appearance, and seminiferous tubule morphology. All young male mice, regardless of genotype, successfully impregnate their female partners .

How does Csnk1g2 regulate necroptosis in testicular cells?

Csnk1g2 functions as a suppressor of necroptosis in testicular cells through mechanisms involving the regulation of key necroptosis signaling components. Evidence supporting this role includes:

• Enhanced MLKL Phosphorylation: Testicular tissue from 12-month-old Csnk1g2 knockout mice shows prominently increased phosphorylation of MLKL at Serine 345, a definitive marker of necroptosis activation, compared to wild-type littermates .

• Western Blot Confirmation: While total protein levels of RIPK1, RIPK3, and MLKL remain constant across genotypes and ages, phospho-serine345-MLKL is exclusively detected in testis extracts from aged Csnk1g2 knockout mice, confirming enhanced activation of the necroptotic pathway .

• In Vitro Verification: Cell culture experiments demonstrate that knocking out Csnk1g2 significantly enhances the necroptosis response in testicular cells .

The molecular mechanism may involve direct regulation of the RIPK1/RIPK3/MLKL necroptosis signaling axis, potentially through phosphorylation events that modulate protein interactions or activity. The age-dependent manifestation of this regulatory function suggests that Csnk1g2's protective role becomes particularly critical during aging, when cells may be more vulnerable to stress-induced cell death pathways .

What is the relationship between Csnk1g2 and reproductive aging?

Csnk1g2 appears to play a protective role against age-associated reproductive decline in male mice. The evidence for this includes:

• Accelerated Testicular Aging: Csnk1g2 knockout mice show premature aging phenotypes in testicular tissue by 12 months of age, including reduced testis size and extensive degeneration of seminiferous tubules, with approximately 31% of tubules becoming completely empty compared to just 2% in wild-type littermates .

• Dramatic Fertility Reduction: While young (2-month-old) Csnk1g2 knockout males show normal fertility, aged (12-month-old) knockout males experience severe fertility impairment, with only 8% capable of producing offspring compared to 83% of age-matched wild-type males .

• Necroptosis Activation: The accelerated testicular aging in Csnk1g2 knockout mice is associated with increased activation of necroptosis, as evidenced by elevated phospho-MLKL levels .

The molecular link between Csnk1g2, necroptosis suppression, and reproductive aging suggests a model where this kinase normally functions to prevent excessive cell death in testicular tissue during aging. When this protective mechanism is lost in knockout animals, enhanced necroptosis leads to accelerated degeneration of seminiferous tubules and consequent decline in reproductive capacity .

How can recombinant Csnk1g2 be produced for experimental use?

Recombinant Csnk1g2 production involves several critical steps, each requiring careful optimization:

• Cloning and Vector Selection: The full-length mouse Csnk1g2 cDNA should be PCR-amplified from a verified cDNA library using high-fidelity polymerase (such as KOD polymerase). The amplified sequence can be subcloned into appropriate expression vectors such as pCDNA3.1 or pWPI, optionally incorporating epitope tags (Myc, Flag, HA) to facilitate purification and detection .

• Mutagenesis Options: For functional studies, researchers may consider generating point mutations using site-directed mutagenesis approaches. Key mutations include:

  • K75A: Disrupts the ATP-binding site, creating a kinase-dead variant

  • D165N: Affects the catalytic domain

  • S211A and/or T215A: Modifies regulatory phosphorylation sites

• Expression Systems: For mammalian expression, common cell lines include HEK293T cells transfected with the expression constructs using appropriate transfection reagents. For bacterial expression (E. coli), codon-optimized sequences in pET-based vectors may improve yield.

• Purification Strategy: Affinity chromatography utilizing the incorporated epitope tags (e.g., His-tag, GST-tag) provides an efficient purification method. This should be followed by size-exclusion chromatography to ensure homogeneity.

• Activity Verification: The purified recombinant protein should be tested for kinase activity using established in vitro kinase assays with appropriate substrates (such as casein).

When working with recombinant proteins, researchers should note that detection methods like ELISA kits are typically optimized for native samples rather than recombinant proteins, which may have different sequences or tertiary structures compared to the native protein .

What approaches are effective for generating Csnk1g2 knockout models?

Based on the search results, successful Csnk1g2 knockout models have been generated using CRISPR-Cas9 technology. The key steps in this process include:

• gRNA Design: Custom gRNAs targeting the Csnk1g2 gene should be designed and cloned into an appropriate Cas9-expressing vector, such as pX458-GFP, which allows for co-expression of both the Cas9 nuclease and the gRNA .

• Transfection: The CRISPR-Cas9 construct should be transfected into target cells (such as MEFs for establishing cell lines, or embryonic cells for generating knockout mice) using appropriate transfection reagents like FuGENEHD .

• Selection Strategy: For cell line generation, GFP-positive cells can be sorted using flow cytometry (e.g., BD FACSArial cell sorter) 3 days post-transfection, and single clones can be isolated and expanded .

• Knockout Verification:

  • Protein level: Western blotting using anti-Csnk1g2 antibodies

  • Genomic level: PCR amplification and DNA sequencing of the targeted region

For animal models, verified embryonic stem cells can be used for blastocyst injection, or direct zygote injection of CRISPR components can be performed. Genotyping of offspring can be conducted using specific primer pairs:

• Csnk1g2-KO-F: AGGTTTCGCACTCGGATCTCACG

• Csnk1g2-KO-R: CCCCGAAGTTCCCACAGCCTATC

What detection methods are most suitable for measuring Csnk1g2 expression and activity?

Multiple complementary approaches can be employed to comprehensively assess Csnk1g2 expression and activity:

• Expression Levels:

  • ELISA: Quantifies Csnk1g2 protein concentration in tissue homogenates, cell lysates, and biological fluids within a detection range of 0.156-10 ng/ml .

  • Western Blotting: Visualizes Csnk1g2 protein expression and can be semi-quantitative when normalized to housekeeping proteins. Rabbit polyclonal antibodies at 1 μg/mL concentration are typically effective .

  • qRT-PCR: Measures Csnk1g2 mRNA expression levels, requiring appropriate reference genes for normalization.

• Localization:

  • Immunohistochemistry: Reveals tissue distribution patterns in fixed, paraffin-embedded sections .

  • Immunofluorescence: Provides high-resolution subcellular localization data and enables co-localization studies with other proteins .

• Activity Assessment:

  • In vitro kinase assays: Measures the ability of immunoprecipitated or recombinant Csnk1g2 to phosphorylate substrate proteins.

  • Phospho-specific antibodies: Detects phosphorylation of known Csnk1g2 substrates.

  • Mass spectrometry: Identifies phosphorylation sites on substrate proteins. Techniques can include CID (collision-induced dissociation) and HCD (high-energy collisional dissociation) for MS/MS scans .

• Functional Readouts:

  • Cell survival assays: Cell Titer-Glo Luminescent Cell Viability Assay can be used to evaluate the effects of Csnk1g2 manipulation on cell viability .

  • Necroptosis markers: Phospho-Serine345-MLKL can serve as a functional readout for necroptosis activation in Csnk1g2-manipulated systems .

Each method has specific sample preparation requirements and optimal detection parameters. For instance, when using immunohistochemistry or immunofluorescence, tissue samples should undergo proper fixation (e.g., formalin fixation) followed by appropriate storage conditions (70% ethanol at 4°C) .

How do Csnk1g2 knockout phenotypes compare between different experimental systems?

Csnk1g2 knockout phenotypes have been studied in both cellular and animal models, with important differences in manifestation:

• Cellular Models:

  • MEF (Mouse Embryonic Fibroblast) Csnk1g2 knockout cells show enhanced sensitivity to necroptosis-inducing stimuli .

  • The phenotype is observable immediately after knockout generation and does not require aging.

  • Effects are cell-autonomous and can be directly linked to molecular mechanisms.

• Animal Models:

  • Whole-body Csnk1g2 knockout mice show age-dependent phenotypes that primarily manifest by 12 months of age .

  • Young (2-month-old) knockout mice appear normal in all measured parameters .

  • The reproductive phenotype involves complex tissue interactions and systemic effects, including:

    • Increased body weight

    • Enlarged seminal vesicles

    • Testicular degeneration

    • Fertility decline

• Temporal Aspects:

  • The age-dependency of the in vivo phenotype suggests that Csnk1g2's protective function becomes particularly important during aging.

  • This temporal component may be missed in acute cellular experiments, highlighting the importance of longitudinal studies in animal models.

These comparisons emphasize the complementary nature of different experimental systems, with cellular models providing mechanistic insights and animal models revealing physiological relevance and temporal dynamics. The synthesis of findings across these systems provides a more complete understanding of Csnk1g2 function in health and disease.