Recombinant Mouse Clavesin-2 (Clvs2)

What is Clavesin-2 and how does it relate to the Clavesin protein family?

Clavesin-2 (Clvs2) is a member of the clavesin family of neuron-specific lipid- and clathrin-binding proteins. The clavesin family consists of Clavesin-1 and Clavesin-2, which were identified in proteomic analyses of rat brain clathrin-coated vesicles (CCVs) . These proteins are characterized by a Sec14 domain flanked by a short stretch of residues on the N-terminal side and an approximately 75 residue C-terminal region ending in a putative clathrin box, which mediates clathrin binding . While the CRAL_TRIO_N module is often annotated as a separate entity, it is actually a component of the globular Sec14 domain .

Clavesins are exclusively expressed in neurons and appear to provide unique neuron-specific regulation of late endosome/lysosome functions . They are detected in brain tissue but are undetectable in non-neuronal tissues and various cell lines, even with extended exposure in Western blot analyses . This highly specific expression pattern suggests specialized roles in neuronal membrane trafficking.

What is the molecular structure and biochemical properties of mouse Clavesin-2?

Mouse Clavesin-2 is characterized by its Sec14 domain architecture, which is involved in lipid binding and trafficking . In Western blots of brain extracts, Clavesin-2 appears as the upper band of a doublet (with Clavesin-1 being the lower band), migrating slightly slower than the 40 kDa marker .

The protein contains a functional clathrin box motif at its C-terminus, enabling interactions with clathrin coat components . This interaction is supported by the partial co-localization of clavesins with AP-1 adaptor proteins and clathrin heavy chain (CHC) in neuronal cells .

Unlike soluble cytosolic proteins, Clavesin-2 demonstrates strong membrane association, appearing predominantly in membrane pellet fractions during subcellular fractionation experiments . This membrane association is likely mediated through both protein-protein interactions and lipid-binding capabilities of the Sec14 domain.

What is the tissue distribution pattern of Clavesin-2 and how can it be detected?

Clavesin-2 demonstrates a highly specific tissue distribution pattern. The protein is detected exclusively in brain tissue and is undetectable in non-neuronal tissues or various cell lines, even with extended exposure in Western blot analyses . This neuron-specific expression suggests specialized functions in neuronal cells.

Within the brain, Clavesin-2 is detected by immunofluorescence in MAP2-positive neurons but not in glial fibrillary acidic protein-positive astrocytes . The neuronal staining pattern is punctate and prominent in cell bodies, with enrichment in perinuclear compartments .

For detection of endogenous Clavesin-2, researchers have successfully used polyclonal antibodies generated against peptides from the C-terminus of Clavesin-1 that cross-react with Clavesin-2 . Isoform-specific detection can be achieved through careful analysis of the protein migration pattern on Western blots, where Clavesin-2 appears as the upper band of a characteristic doublet .

What is the subcellular localization of Clavesin-2 in neurons?

Subcellular fractionation of brain lysates reveals that Clavesin-2 is most prominent in the pellet fractions, indicating its association with membranes . The distribution pattern of Clavesin-2 differs from that of Clavesin-1:

Clavesin-2 puncta in the perinuclear region partially overlap with TGN38, which localizes to the trans-Golgi network (TGN) . Little co-localization is seen with the cis-Golgi protein GM130 . Clavesins also partially co-localize with AP-1 and clathrin heavy chain (CHC) . This localization pattern suggests involvement in membrane trafficking processes, particularly at the TGN and potentially in endosomal compartments.

How can recombinant mouse Clavesin-2 be expressed and purified for experimental use?

Based on methodologies used for clavesin proteins, the following approach can be applied for expressing and purifying recombinant mouse Clavesin-2:

• cDNA Template Preparation: Use mouse Clavesin-2 cDNA as PCR template to amplify the full-length coding sequence. Based on approaches used for human clavesin 2 (gi115527290), appropriate primers should be designed to include restriction sites for subsequent cloning .

• Vector Selection and Tagging: Clone the PCR products into appropriate expression vectors:

  • For bacterial expression with GST tag: pGEX-6P1 or equivalent

  • For mammalian expression with FLAG tag: pCMV-Tag2B or equivalent

  • For fluorescent protein fusion: pEGFP-C1 or equivalent

• Expression System Selection: Choose based on experimental requirements:

  • Bacterial expression provides high yield but may lack mammalian post-translational modifications

  • Mammalian expression (e.g., HEK293) ensures proper folding and modifications but with lower yield

  • Consider insect cell systems (Sf9, Hi5) as an intermediate option

• Purification Strategy:

  • For GST-tagged proteins: Glutathione affinity chromatography followed by PreScission protease cleavage

  • For His-tagged proteins: Immobilized metal affinity chromatography

  • Include size exclusion chromatography as a final polishing step

• Quality Control: Verify protein identity and purity using:

  • SDS-PAGE with Coomassie staining

  • Western blotting with anti-Clavesin-2 antibodies

  • Mass spectrometry for accurate molecular weight determination

What are the recommended methods for studying Clavesin-2 localization in neuronal cells?

To study the localization of Clavesin-2 in neuronal cells, several complementary approaches can be employed:

• Immunofluorescence with Fixed Cells:

  • Culture primary neurons or neuronal cell lines on coverslips

  • Fix cells in 4% paraformaldehyde for 10 minutes

  • Wash in PBS and permeabilize in PBS with 0.2% Triton X-100

  • Block in PBS with 1% bovine serum albumin and 0.02% Triton X-100

  • Incubate with primary antibodies against Clavesin-2 and compartment markers

  • Wash and incubate with fluorescent secondary antibodies

  • Mount coverslips and image using confocal microscopy

• Expression of Fluorescent Fusion Proteins:

  • Transfect neurons with GFP-Clavesin-2 constructs

  • For early endosome visualization, co-transfect with mCherry-FYVE (PtdIns 3-phosphate-binding domain from Hrs)

  • For optimal transfection efficiency in primary neurons, transfect at 6 DIV and image at 7 DIV

  • Compare localization patterns with established compartment markers

• Live-Cell Imaging:

  • Express GFP-Clavesin-2 in neurons

  • Use temperature-controlled imaging chamber with appropriate culture medium

  • Track protein dynamics using time-lapse confocal or TIRF microscopy

  • Apply pharmacological treatments to test effects on protein localization and dynamics

• Correlative Light and Electron Microscopy:

  • Perform immunofluorescence to identify Clavesin-2-positive structures

  • Process the same sample for electron microscopy

  • Correlate fluorescence with ultrastructural features to precisely define Clavesin-2 localization

How can researchers validate the specificity of Clavesin-2 detection in their experiments?

When studying Clavesin-2, researchers should implement multiple validation strategies to ensure specificity:

• Knockdown/Knockout Controls:

  • Design microRNA (miRNA) sequences targeting mouse Clavesin-2 mRNA. Based on approaches used for rat clavesin 2, effective target regions might include nucleotides around positions 1087 and 1186

  • Include non-targeting miRNA controls (e.g., sequence AATTCTCCGAACGTGTCACGT)

  • Verify knockdown efficiency by Western blotting

  • Confirm loss of immunofluorescence signal in knockdown cells

• Antibody Validation:

  • Test antibodies on brain extracts from different species to confirm cross-reactivity

  • Include non-neuronal tissues as negative controls (clavesins are neuron-specific)

  • Perform peptide competition assays to confirm binding specificity

  • Compare staining patterns with multiple antibodies targeting different epitopes

• Recombinant Protein Controls:

  • Overexpress tagged versions of Clavesin-2 as positive controls

  • Use purified recombinant protein for Western blot standards

  • Generate mutant versions (e.g., domain deletions) to confirm epitope specificity

• Imaging Controls:

  • Include secondary antibody-only controls to assess background fluorescence

  • Use spectral unmixing for multi-color imaging to prevent bleed-through artifacts

  • Implement randomized blinded analysis of microscopy data to prevent bias

How can researchers investigate Clavesin-2's functional relationship with the endosomal-lysosomal system?

To explore Clavesin-2's role in the endosomal-lysosomal system, consider these methodological approaches:

• Perturbation Experiments:

  • Deplete Clavesin-2 using isoform-specific miRNAs

  • Overexpress wild-type or mutant Clavesin-2 (e.g., clathrin box mutants)

  • Quantify effects on lysosome morphology, size, and distribution using markers like LAMP1

  • Measure changes in lysosomal pH using ratiometric probes (e.g., LysoSensor)

• Trafficking Assays:

  • Track endocytosis of fluorescently labeled cargoes (e.g., EGF, transferrin)

  • Measure degradation rates of known lysosomal substrates

  • Use tandem fluorescent proteins (e.g., mRFP-GFP-LC3) to monitor autophagosome-lysosome fusion

  • Implement pulse-chase experiments with lysosomal hydrolase precursors

• Interaction Studies:

  • Identify Clavesin-2 binding partners using proximity labeling (BioID, APEX)

  • Perform co-immunoprecipitation with endosomal/lysosomal proteins

  • Test interactions with members of the ESCRT machinery

  • Investigate potential associations with retromer components

• Disease Model Analysis:

  • Examine Clavesin-2 expression and localization in models of lysosomal storage disorders

  • Assess Clavesin-2 status in neurodegenerative disease models with endolysosomal defects

  • Test whether Clavesin-2 modulation can rescue phenotypes in these models

What are the methodological approaches for investigating Clavesin-2's interactions with lipids?

Given that Clavesin-2 contains a Sec14 domain implicated in lipid binding, several specialized techniques can be employed:

• Lipid Binding Assays:

  • Protein-lipid overlay assays using PIP strips or arrays

  • Liposome flotation assays with defined lipid compositions

  • Surface plasmon resonance with immobilized lipids

  • Isothermal titration calorimetry for binding affinity determination

• Structure-Function Analysis:

  • Generate point mutations in the Sec14 domain based on structural predictions

  • Perform lipid binding assays with mutant proteins

  • Assess effects of mutations on subcellular localization

  • Create chimeric proteins exchanging Sec14 domains with other lipid-binding proteins

• Cellular Lipid Manipulation:

  • Treat neurons with specific lipid-modifying enzymes

  • Use pharmacological inhibitors of lipid metabolism

  • Employ optogenetic tools for acute lipid composition changes

  • Analyze consequences for Clavesin-2 localization and function

• Advanced Imaging Approaches:

  • Use fluorescent lipid analogs to track co-localization with Clavesin-2

  • Implement Förster resonance energy transfer (FRET) between labeled Clavesin-2 and lipid probes

  • Apply super-resolution microscopy to precisely define Clavesin-2 localization relative to lipid domains

  • Perform live-cell imaging to monitor dynamic responses to lipid perturbations

How does Clavesin-2 functionally compare with Clavesin-1, and what experimental designs can distinguish their roles?

Understanding the functional differences between Clavesin-1 and Clavesin-2 requires specialized experimental approaches:

• Comparative Expression Analysis:

  • Quantitative PCR and Western blotting across brain regions and developmental stages

  • Single-cell RNA sequencing to identify cell type-specific expression patterns

  • In situ hybridization for precise spatial mapping

  • Proteomics analysis of different neuronal populations

• Differential Localization Studies:

  • Generate truly isoform-specific antibodies (challenging but valuable)

  • Express differently tagged versions (e.g., GFP-Clavesin-1 and mCherry-Clavesin-2)

  • Perform detailed subcellular fractionation studies

  • Compare subcellular distribution patterns quantitatively

• Functional Differentiation:

  • Isoform-specific knockdown using targeted miRNAs

  • Rescue experiments with RNAi-resistant constructs

  • Chimeric protein approaches to map domain-specific functions

  • Proteomics analysis of isoform-specific interaction partners

• Phenotypic Analysis:

  • Quantify effects on lysosome size and distribution after isoform-specific manipulation

  • Measure membrane trafficking kinetics in the presence/absence of each isoform

  • Assess neuronal morphology and function after selective depletion

  • Evaluate subcellular responses to stress conditions

The current research shows that Clavesin-1 is enriched in the P3 microsomal fraction, whereas Clavesin-2 is more evenly distributed between membrane fractions , suggesting functional differences that warrant further investigation.

What approaches can resolve contradictory data when studying Clavesin-2 in different experimental systems?

When faced with conflicting results in Clavesin-2 research, consider these troubleshooting and resolution strategies:

• System-Specific Variables:

  • Compare primary neurons with neuronal cell lines systematically

  • Assess developmental stage-dependent differences in neuronal cultures

  • Consider species-specific variations (mouse vs. rat vs. human Clavesin-2)

  • Evaluate the effects of culture conditions on protein expression and localization

• Methodological Standardization:

  • Implement consistent protocols for tissue preparation and fractionation

  • Standardize antibody concentrations and immunostaining procedures

  • Use multiple detection methods to confirm findings

  • Document all experimental parameters in detail to enable proper replication

• Quantitative Analysis:

  • Develop rigorous quantification methods for microscopy data

  • Perform statistical analyses with appropriate controls

  • Implement blinded analysis to minimize bias

  • Consider biological variability versus technical artifacts

• Integration of Multiple Approaches:

  • Combine biochemical, imaging, and functional analyses

  • Validate key findings using in vivo models when possible

  • Implement genetic approaches (CRISPR/Cas9) for definitive mechanistic studies

  • Collaborate with specialists in different techniques to validate findings