Recombinant Mouse GRAM domain-containing protein 1B (Gramd1b)

What is GRAM Domain-containing Protein 1B (Gramd1b)?

Gramd1b, also known as Protein Aster-B, is a cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane. It belongs to the family of GRAM domain-containing proteins, which are characterized by the presence of a GRAM domain (Glucosyltransferases, Rab-like GTPase activators and Myotubularins) . The protein plays important roles in cellular cholesterol homeostasis and has been implicated in various physiological and pathological processes including cancer cell migration and multiple sclerosis pathophysiology .

Where is Gramd1b expressed in normal tissues?

Gramd1b is expressed in multiple cell types within both the central nervous system (CNS) and peripheral tissues. Within the CNS, Gramd1b expression has been detected in astrocytes, microglia, and neurons. In peripheral tissues, it is expressed in monocytes and macrophages . This wide expression pattern suggests that Gramd1b may have important functions in various tissues and cell types, making it a protein of interest across multiple research disciplines.

What is the molecular structure of mouse Gramd1b?

Mouse Gramd1b is a protein consisting of 738 amino acids (AA 1-738) . The protein contains a characteristic GRAM domain, which is a functional domain of approximately 70 amino acids found in several proteins involved in membrane-associated processes. Additionally, Gramd1b contains regions responsible for cholesterol binding and membrane association. The full-length protein can be expressed as a recombinant protein with various tags (such as His or GST) for experimental purposes .

How can I detect Gramd1b in experimental samples?

Gramd1b can be detected using several methodological approaches:

• Western Blot: Using specific antibodies such as rabbit polyclonal antibodies raised against recombinant Gramd1b. The recommended dilution for Western blot analysis is typically 1:1000 .

• Immunofluorescence: For cellular localization studies, immunofluorescence techniques using specific antibodies can be employed.

• EGFP-tagged constructs: Plasmids encoding EGFP-tagged human GRAMD1B wild-type (EGFP-GRAMD1Bwt) can be generated for visualization in living cells and localization studies .

• qPCR: For mRNA expression analysis, specific primers targeting Gramd1b can be designed for quantitative PCR experiments.

When selecting detection methods, consider the experimental goals, available resources, and the specific aspects of Gramd1b you aim to study.

What is the role of Gramd1b in cancer cell migration?

Gramd1b has been identified as a key negative regulator of cancer cell migration, particularly in breast cancer. Research has revealed several important mechanistic aspects:

• Morphological changes: Gramd1b knockdown causes distinct morphological changes in breast cancer cells, characterized by the formation of membrane ruffling and protrusions, which are cellular features associated with enhanced migratory capacity .

• Signaling pathway modulation: Gramd1b inhibits cancer cell migration by negating both JAK/STAT and Akt signaling pathways. Knockdown of Gramd1b leads to JAK2/STAT3 and Akt activation, which promotes a pro-migratory phenotype .

• Rho GTPase regulation: Gramd1b inhibition significantly increases the levels of the Rho family of GTPases, which are critical regulators of cellular migration and cytoskeletal dynamics .

• Pharmacological intervention: JAK2 or Akt inhibition efficiently suppresses the enhanced migratory phenotype caused by Gramd1b knockdown, suggesting potential therapeutic strategies for cancers with low Gramd1b expression .

These findings collectively suggest that Gramd1b functions as a key signaling molecule that inhibits cell migration in breast cancer by negatively regulating both JAK/STAT and Akt signaling pathways.

How is Gramd1b implicated in multiple sclerosis pathophysiology?

Recent whole-genome sequencing studies have revealed a potential role for Gramd1b in multiple sclerosis (MS) pathophysiology:

• Genetic variants: A novel missense c.1801T > C (p.S601P) variant in the Gramd1b gene has been identified in a consanguineous Italian family with multiple affected MS members. This variant resides under a linkage peak (LOD: 2.194) .

• Additional rare variants: Sequencing of Gramd1b in 91 familial MS cases revealed additional rare missense and splice-site variants, some of which (rs755488531 and rs769527838) were not found in 1000 Italian healthy controls .

• Expression changes in MS lesions: Notably, Gramd1b was found to be downregulated in vessel-associated astrocytes of active MS lesions in autopsied brains .

• Inflammatory response: Gramd1b was downregulated by inflammatory stimuli in peripheral monocytes, suggesting a possible role in the modulation of inflammatory response in MS pathophysiology .

These findings suggest that Gramd1b may play a role in MS pathogenesis, potentially through modulation of inflammatory responses and possibly affecting cholesterol transport in the central nervous system.

What experimental methods can be used for functional studies of Gramd1b?

Several experimental approaches have been successfully employed for functional studies of Gramd1b:

• Gene knockdown studies: siRNA or shRNA targeting Gramd1b can be used to reduce protein expression and study resulting phenotypes in various cell types .

• Overexpression studies: Transfection of cells with plasmids encoding Gramd1b (such as EGFP-GRAMD1Bwt constructs) allows for gain-of-function experiments .

• Cell migration assays: Wound healing assays, transwell migration assays, and real-time cell migration tracking can be used to assess the impact of Gramd1b modulation on cell motility .

• Signaling pathway analysis: Western blotting for phosphorylated forms of signaling molecules (such as p-JAK2, p-STAT3, and p-Akt) can be used to study how Gramd1b affects intracellular signaling cascades .

• Pharmaceutical intervention: Combining Gramd1b knockdown or overexpression with specific inhibitors (such as JAK2 inhibitor AG490) can help elucidate the mechanism of action and pathway interactions .

• Construct generation protocol: For plasmid construction, a full-length clone can be amplified using specific primers (e.g., 3′-BamHI-GRAMD1B_Fw: GCGGATCCCCATGATAGCGATTCCTCTTTTC and 5′-Xho-GRAMD1B_Rev: GCCTCGAGATGAAAGGATTCAAGCTCTCC) and subcloned into appropriate vectors like pEGFP-N1 .

How does Gramd1b function in cholesterol transport?

Gramd1b (also known as Protein Aster-B) functions as a cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane . Key aspects of its function include:

• Membrane interaction: The protein contains domains that allow it to interact with cellular membranes, particularly the plasma membrane.

• Cholesterol binding: Gramd1b has cholesterol-binding capabilities, allowing it to capture and transport cholesterol molecules.

• Non-vesicular transport: Unlike vesicular transport mechanisms, Gramd1b facilitates the movement of cholesterol between membrane compartments without requiring membrane-enclosed vesicles.

• Cellular cholesterol homeostasis: Through its transport function, Gramd1b contributes to maintaining appropriate cholesterol levels and distribution within cells.

This cholesterol transport function may be particularly relevant in understanding Gramd1b's role in disease contexts, as cholesterol metabolism and distribution are critical for proper cellular function, especially in neurons and other cell types affected in neurological disorders like multiple sclerosis.

How can I design experiments to investigate Gramd1b's role in specific cellular processes?

When designing experiments to investigate Gramd1b's role in specific cellular processes, consider the following methodological approach:

• Expression analysis in target cells:

  • Determine baseline expression levels of Gramd1b in your cell type of interest using Western blot and qPCR

  • Compare expression across different cell types or disease states to identify contexts where Gramd1b may be particularly relevant

• Loss-of-function studies:

  • Design siRNA or shRNA targeting conserved regions of Gramd1b

  • Validate knockdown efficiency at both mRNA and protein levels

  • Observe phenotypic changes in cellular morphology, migration, proliferation, or other relevant processes

  • Analyze effects on related signaling pathways (JAK/STAT, Akt)

• Gain-of-function studies:

  • Express wild-type or mutant Gramd1b (using vectors like pEGFP-N1-GRAMD1B)

  • Assess cellular localization using fluorescent tags

  • Measure effects on cellular processes and signaling pathways

• Pathway analysis:

  • Use specific inhibitors (e.g., AG490 for JAK2) to dissect the relationship between Gramd1b and relevant signaling pathways

  • Perform epistasis experiments to determine hierarchical relationships between Gramd1b and other signaling components

• Disease model integration:

  • For cancer studies, assess how Gramd1b expression correlates with migration, invasion, and metastasis

  • For MS studies, examine how inflammatory stimuli affect Gramd1b expression and function in relevant cell types

This systematic approach will help elucidate Gramd1b's specific roles in your cellular process of interest while connecting findings to broader disease contexts.

What controls should I include when working with recombinant Gramd1b protein?

When working with recombinant Gramd1b protein, proper experimental controls are essential to ensure result validity and interpretation:

• Tag-only control: Include a control protein with the same tag (His, GST, etc.) but without the Gramd1b sequence to distinguish tag-specific effects from Gramd1b-specific effects .

• Heat-inactivated Gramd1b: For functional studies, include heat-denatured Gramd1b to confirm that observed effects require properly folded protein.

• Concentration gradient: Use multiple concentrations of recombinant Gramd1b to establish dose-response relationships.

• Species-specific controls: When studying cross-species interactions, include both mouse and human Gramd1b versions to identify species-specific effects .

• Buffer controls: Include buffer-only conditions to control for any effects of stabilizers or preservatives in the protein preparation (e.g., glycerol, sodium azide) .

• Cell type controls: When studying cellular responses, test effects in multiple cell types, including those known to express or not express endogenous Gramd1b.

• Validation with endogenous protein: Whenever possible, compare results obtained with recombinant protein to those observed with endogenous Gramd1b through knockdown or overexpression approaches.

These controls will help distinguish specific Gramd1b-mediated effects from experimental artifacts and provide more robust and reproducible results.

How can I optimize detection of Gramd1b in different experimental systems?

Optimizing Gramd1b detection across different experimental systems requires consideration of several technical factors:

• Western blot optimization:

  • Use recommended antibody dilution (typically 1:1000)

  • Try different blocking agents (BSA vs. milk)

  • Optimize transfer conditions for this large protein (738 AA)

  • Consider gradient gels for better resolution

  • Include positive controls (recombinant protein) and negative controls (lysates from Gramd1b knockdown cells)

• Immunocytochemistry optimization:

  • Test multiple fixation methods (paraformaldehyde, methanol)

  • Optimize permeabilization conditions

  • Try antigen retrieval methods if needed

  • Use fluorescently-tagged Gramd1b constructs as positive controls

• qPCR detection:

  • Design primers spanning exon junctions to avoid genomic DNA amplification

  • Validate primer efficiency using standard curves

  • Use multiple reference genes for normalization

  • Include no-template and no-RT controls

• Protein expression system selection:

  • Different expression systems provide varying protein yields and post-translational modifications

  • HEK-293 cells are commonly used for mammalian expression

  • Cell-free protein synthesis (CFPS) systems are alternatives

  • Consider purification methods compatible with your tag (His, Strep, etc.)

• Quality control metrics:

  • Purity assessment by SDS-PAGE (target >90% for most applications)

  • Western blot with tag-specific antibodies

  • Analytical SEC (HPLC) for aggregation assessment

  • Functional assays to confirm activity

By systematically optimizing these parameters, you can achieve reliable and consistent detection of Gramd1b across different experimental platforms.

How can I interpret contradictory results regarding Gramd1b function?

When faced with contradictory results regarding Gramd1b function, consider these analytical approaches:

• Context-dependent effects:

  • Gramd1b may have different functions in different cell types or tissues

  • For example, while Gramd1b inhibits migration in breast cancer cells , its role may differ in other contexts

  • Record and compare the specific experimental conditions under which contradictory results were obtained

• Isoform-specific functions:

  • Check whether your studies targeted the same Gramd1b isoforms

  • Different splice variants may have distinct functions

  • Verify which regions of the protein were manipulated in different studies

• Concentration-dependent effects:

  • Some proteins exhibit opposite effects at different concentrations

  • Consider whether knockdown versus complete knockout may yield different phenotypes

  • Perform dose-response experiments to identify potential biphasic effects

• Pathway integration:

  • Gramd1b interacts with multiple signaling pathways (JAK/STAT, Akt)

  • The relative activation states of these pathways in different model systems may alter Gramd1b's effects

  • Investigate the status of related pathways in your experimental system

• Technical considerations:

  • Different antibodies may recognize different epitopes or have varying specificities

  • Recombinant proteins with different tags may behave differently

  • The timing of measurements after manipulation may reveal transient versus sustained effects

What are common technical challenges when working with Gramd1b and how can they be addressed?

Researchers working with Gramd1b may encounter several technical challenges that can be addressed through specific methodological adjustments:

• Protein solubility issues:

  • Challenge: Gramd1b contains membrane-interacting domains that may cause aggregation during recombinant expression

  • Solution: Use mild detergents in purification buffers, optimize expression temperature, consider fusion tags that enhance solubility

• Antibody specificity:

  • Challenge: Commercially available antibodies may cross-react with related GRAM domain-containing proteins

  • Solution: Validate antibodies using Gramd1b knockout or knockdown samples, compare multiple antibodies targeting different epitopes, use epitope-tagged versions for definitive detection

• Functional redundancy:

  • Challenge: Other GRAM domain family members may compensate for Gramd1b loss

  • Solution: Consider simultaneous knockdown of multiple family members, use acute manipulation strategies, validate phenotypes across multiple model systems

• Cholesterol-dependent effects:

  • Challenge: As a cholesterol transporter, Gramd1b function may vary with cellular cholesterol content

  • Solution: Control or measure cholesterol levels in experimental systems, test manipulations under different cholesterol conditions

• Low endogenous expression:

  • Challenge: Endogenous Gramd1b may be expressed at low levels in some cell types

  • Solution: Use sensitive detection methods (enhanced chemiluminescence for Western blots, amplification steps in immunostaining), concentrate samples when possible

• Localization challenges:

  • Challenge: Gramd1b's dynamic localization between membranes can complicate imaging

  • Solution: Use live-cell imaging with fluorescently tagged constructs, employ subcellular fractionation techniques, perform co-localization studies with organelle markers

By anticipating these technical challenges and implementing appropriate solutions, researchers can generate more reliable and interpretable data when studying Gramd1b.

How do I analyze Gramd1b's interactions with JAK/STAT and Akt signaling pathways?

Analyzing Gramd1b's interactions with JAK/STAT and Akt signaling pathways requires a systematic approach:

• Baseline signaling assessment:

  • Measure baseline phosphorylation levels of key signaling molecules (p-JAK2, p-STAT3, p-Akt) in your system

  • Compare levels between normal and disease states or different cell types

• Gramd1b manipulation effects:

  • After Gramd1b knockdown or overexpression, analyze changes in pathway activation

  • Research has shown that Gramd1b knockdown is associated with JAK2/STAT3 and Akt activation

  • Measure these effects at multiple time points to capture both immediate and adaptive responses

• Pathway inhibitor studies:

  • Use specific inhibitors like AG490 (JAK2 inhibitor) to determine if blocking these pathways reverses phenotypes caused by Gramd1b manipulation

  • Findings indicate that JAK2 or Akt inhibition efficiently suppresses the enhanced migratory phenotype caused by Gramd1b knockdown

• Cross-pathway interactions:

  • Investigate the relationship between JAK/STAT and Akt pathways in your system

  • Interesting cross-talk has been observed, such as AG490 dose-dependently increasing p-Akt levels

  • Use epistasis experiments to determine the hierarchy of these interactions

• Functional readouts:

  • Connect signaling changes to functional outcomes (migration, proliferation, etc.)

  • Assess whether pathway inhibitors can normalize these functional outcomes

  • Determine threshold levels of pathway activation required for phenotypic changes

• Mechanistic investigation:

  • Explore whether Gramd1b directly interacts with components of these pathways

  • Investigate whether cholesterol transport function is required for signaling effects

  • Consider how membrane organization might influence receptor clustering and signaling

This systematic analysis will help elucidate the complex relationship between Gramd1b and these important signaling pathways, which appear central to its role in processes like cancer cell migration.

What are promising areas for future research on Gramd1b?

Several promising research directions for Gramd1b investigation include:

• Structural studies:

  • Determine the three-dimensional structure of Gramd1b to better understand its cholesterol-binding mechanism

  • Investigate how structure relates to membrane association and intermembrane transport functions

  • Explore structural changes that occur upon cholesterol binding or protein-protein interactions

• Expanded disease relevance:

  • Beyond the established roles in breast cancer and multiple sclerosis , investigate Gramd1b's potential involvement in:

    • Other neurodegenerative disorders where cholesterol metabolism is implicated

    • Additional cancer types, particularly those with altered cholesterol metabolism

    • Metabolic disorders affecting lipid homeostasis

• In vivo models:

  • Develop and characterize Gramd1b knockout or conditional knockout mouse models

  • Examine tissue-specific roles using conditional expression systems

  • Test the effects of Gramd1b manipulation in disease models (cancer metastasis, MS, etc.)

• Therapeutic targeting:

  • Design small molecules or peptides that could modulate Gramd1b function

  • Explore whether enhancing Gramd1b activity could reduce cancer cell migration

  • Investigate whether restoring Gramd1b function in MS contexts might have therapeutic benefits

• Integration with cholesterol biology:

  • Elucidate how Gramd1b's cholesterol transport function connects to its roles in JAK/STAT and Akt signaling

  • Investigate whether membrane cholesterol organization affects receptor clustering and signaling

  • Explore interactions with other cholesterol regulatory proteins

These research directions build upon current knowledge while extending into unexplored territories that may yield significant insights into Gramd1b biology and its potential as a therapeutic target.

How might Gramd1b research translate to therapeutic applications?

Gramd1b research shows several promising avenues for therapeutic applications:

• Cancer metastasis inhibition:

  • Given that Gramd1b inhibits cancer cell migration , enhancing its expression or activity might reduce metastatic potential

  • Therapeutic approaches could include:

    • Small molecules that mimic Gramd1b's inhibitory effects on JAK/STAT or Akt signaling

    • Gene therapy approaches to restore Gramd1b expression in tumors with reduced levels

    • Combination therapies targeting both Gramd1b-regulated pathways and other migration mechanisms

• Multiple sclerosis interventions:

  • The identification of Gramd1b variants in MS patients and its downregulation in MS lesions suggests potential therapeutic relevance

  • Possible approaches include:

    • Targeting inflammatory pathways that downregulate Gramd1b

    • Modulating cholesterol transport in affected CNS regions

    • Developing therapies specific to patients with identified Gramd1b variants

• Biomarker development:

  • Gramd1b expression or variant status could serve as:

    • A prognostic marker in cancer to predict metastatic potential

    • A stratification marker for MS patients who might benefit from specific therapies

    • A pharmacodynamic marker to assess treatment effects on relevant pathways

• Cholesterol-related disorders:

  • As a cholesterol transporter , Gramd1b modulation might benefit conditions involving deranged cholesterol homeostasis

  • This could include certain neurodegenerative diseases where cholesterol metabolism is altered

• Targeted delivery strategies:

  • Nanoparticles or other delivery vehicles could be designed to target cells with altered Gramd1b expression

  • Cell-specific delivery of therapeutics might enhance efficacy while reducing side effects

Translational development would require additional validation in preclinical models, mechanism clarification, and eventually clinical studies to determine safety and efficacy in human patients.