Recombinant Mouse Neuropeptide Y receptor type 1 (Npy1r)

What is the expression profile of Npy1r in mouse tissues?

Npy1r is expressed in multiple tissues and cell types in mice. Expression has been confirmed in lymph node cells from myelin oligodendrocyte glycoprotein (MOG)-sensitized animals and in nylon wool-purified spleen T cells from naive mice . The receptor is notably expressed in the hippocampus, where it mediates anxiety-related behaviors and affects seizure susceptibility . Npy1r is also expressed in various regions of the cardiovascular system, where it mediates vasoconstrictor responses .

RT-PCR techniques have been successfully employed to detect Npy1r mRNA expression in these tissues. The methodology involves:

• RNA extraction using commercial reagents (e.g., RNABee)

• Reverse transcription with SuperScript First-Strand Synthesis System

• PCR amplification with specific primers (Y1 receptor sense: CTTCGGGGAGACCATGTGCAAACTGAATC; Y1 receptor antisense: AGGAGAGTCGTGTAAGACAG)

• Gel electrophoresis analysis to visualize expression

How does Npy1r signaling affect immune function?

Npy1r plays a significant immunomodulatory role, particularly in T cell function and autoimmune responses. Activation of Npy1r:

• Significantly inhibits the induction of experimental autoimmune encephalomyelitis (EAE), a Th1-mediated autoimmune disease model

• Suppresses antigen-specific Th1 responses

• Biases T cell responses toward a Th2 phenotype

• Directly affects autoimmune T cells via Y1 receptors

• Inhibits interferon-gamma (IFN-γ) production in a dose-dependent manner when T cells are stimulated with anti-CD3 antibodies

These findings establish Npy1r as a potent immunomodulator involved in regulating Th1-mediated autoimmunity. The inhibition of IFN-γ secretion upon Npy1r stimulation suggests it plays a role in shifting the Th1/Th2 balance, potentially offering therapeutic applications in autoimmune conditions.

What experimental approaches are used to study Npy1r function?

Several methodological approaches have been employed to study Npy1r function:

• Pharmacological manipulation: Use of Npy1r agonists such as [d-His26]NPY and [F7,P34]NPY, as well as antagonists like BIBO3304 to study receptor-mediated effects in vivo and in vitro

• Gene therapy approaches: Recombinant adeno-associated viral vectors (rAAV) encoding the Y1 gene (rAAV-Y1) can induce overexpression of functional transgene Y1 receptors in specific brain regions like the hippocampus

• Cytokine assays: Evaluating cytokine secretion (IFN-γ, IL-4) in lymph node cells stimulated with specific antigens using sandwich ELISA to assess Npy1r-mediated immunomodulation

• Real-time PCR: Quantification of Npy1r expression using Light Cycler quantitative PCR systems with commercial kits (e.g., Light Cycler-FastStart DNA Master SYBR Green I)

• Behavioral testing: Assessment of anxiety-like and depression-like behaviors in animal models with altered Npy1r expression using tests such as open field, elevated plus maze, tail suspension, and forced swim tests

How do Npy1r agonists differ in their efficacy and specificity?

Different Npy1r agonists demonstrate varying efficacy in mediating physiological responses, likely reflecting their receptor specificity profiles. Research indicates a clear hierarchy in potency among native NPY and receptor-specific compounds:

This differential efficacy may be explained by several mechanisms:

• Stimulation of non-Y1 receptors by native NPY may compete with Y1 receptor ligation

• Y1 receptor-specific agonists may be more efficacious at inducing intracellular signaling events

• Different compounds may exhibit differential tissue penetration

• Compounds may be differentially degraded by specific enzymes like CD26

These findings highlight the importance of careful ligand selection when investigating Npy1r-mediated responses, and suggest that highly selective agonists are preferable for therapeutic applications targeting specific receptor subtypes.

What are the functional consequences of Npy1r overexpression in specific neural circuits?

Overexpression of Npy1r in specific brain regions produces complex and sometimes paradoxical effects on behavior and neural function. When overexpressed in the hippocampus using rAAV-mediated gene transfer, Npy1r has been found to:

• Confer modest anxiolytic-like effects in behavioral tests including open field and elevated plus maze paradigms

• Show no significant impact on depression-like behaviors in tail suspension and forced swim tests

• Moderately aggravate kainate-induced seizures, suggesting a proconvulsant effect

Recent research has further revealed that Npy1r-expressing neurons may constitute distinct sub-ensembles within memory circuits, particularly in the ventral CA1 region of the hippocampus. These neurons appear to be involved in memory extinction processes and may operate separately from other NPY receptor-expressing populations . This functional segregation suggests complex circuit-specific roles for different NPY receptor subtypes in memory processing.

How does Npy1r interact with other NPY receptor subtypes in mediating physiological responses?

The NPY receptor family includes multiple subtypes (Y1, Y2, Y4, Y5) that have been grouped together due to their ability to bind NPY, despite generally low sequence similarity . The interaction between these receptor systems is complex and context-dependent:

• Opposing functions: While Y1R mediates vasoconstriction, Y2R slows heart rate, and Y5R promotes cardiac hypertrophy, suggesting distinct cardiovascular roles

• Complementary actions: In autoimmune conditions, Y1R activation suppresses EAE, but this effect is abolished when combined with Y1R antagonists, suggesting minimal compensatory action from other receptor subtypes

• Differential tissue expression: Y1R, Y2R, and Y5R are expressed in various cardiovascular tissues, allowing for coordinated but distinct actions

• Memory processing: Recent evidence suggests that Y1R and Y2R are expressed in physically non-overlapping neuronal sub-ensembles, where they may have complementary roles in memory extinction processes

Understanding these interactions is critical for developing targeted therapeutic approaches, as modulation of one receptor subtype may have unintended effects on physiological processes mediated by other subtypes. For example, a Y1R-targeted therapy for anxiety might inadvertently affect cardiovascular function or immune responses.

What are the optimal approaches for inducing and validating Npy1r overexpression in animal models?

Recombinant adeno-associated viral vector (rAAV) gene transfer represents an effective approach for inducing Npy1r overexpression in specific tissues. The methodology includes:

• Vector design: Construction of rAAV vectors encoding the Y1 gene under appropriate promoters

• Stereotaxic delivery: Precise injection of viral vectors into target brain regions

• Validation of overexpression: Multiple complementary approaches should be employed:

  • RT-PCR for mRNA expression

  • Immunohistochemistry for protein localization

  • Functional assays to confirm receptor activity

  • Behavioral or physiological responses to Y1R-specific ligands

Researchers should be aware of potential confounding factors:

• Viral tropism may affect which cell types express the transgene

• Duration of expression should be monitored over time

• Overexpression may lead to compensatory changes in other receptor systems

• The placement and spread of viral injections should be carefully documented

How can researchers effectively distinguish between Npy1r-mediated effects and those of other NPY receptor subtypes?

Differentiating between effects mediated by different NPY receptor subtypes presents a significant experimental challenge. Recommended approaches include:

• Pharmacological tools:

  • Y1R-selective agonists: [d-His26]NPY, [F7,P34]NPY

  • Y1R-selective antagonists: BIBO3304

  • Combined application of receptor-specific compounds with native NPY

• Genetic approaches:

  • Receptor-specific knockout models

  • CRISPR/Cas9-mediated receptor editing

  • Conditional knockout strategies for tissue-specific deletion

• Experimental design considerations:

  • Include appropriate control groups (e.g., native NPY vs. Y1R-specific agonists)

  • Test effects of antagonists alone to assess endogenous receptor function

  • Consider potential compensatory mechanisms in knockout models

  • Assess expression of multiple receptor subtypes to account for potential changes in other systems

• Functional readouts:

  • Select physiological or behavioral measures known to be differentially regulated by specific receptor subtypes

  • Include positive controls for each receptor system

  • Test dose-response relationships to identify receptor-specific thresholds

What are the key considerations for translating Npy1r research findings from mouse models to potential therapeutic applications?

Translating findings from mouse Npy1r studies to clinical applications requires careful consideration of several factors:

• Species differences:

  • Receptor distribution and density may vary between mice and humans

  • Signal transduction pathways might be differentially regulated

  • Pharmacological properties of ligands may differ

• Therapeutic window:

  • The balance between beneficial effects (e.g., anxiolytic, immunomodulatory) and adverse effects (e.g., proconvulsant) must be carefully established

  • Tissue-specific targeting may be required to minimize unwanted effects

• Delivery methods:

  • For CNS applications, blood-brain barrier penetration must be considered

  • For peripheral applications (e.g., immunomodulation), systemic exposure and biodistribution should be characterized

  • Gene therapy approaches may provide tissue-specific targeting but present additional regulatory challenges

• Context-dependent effects:

  • Y1R effects may differ depending on:

    • Disease state (e.g., autoimmune conditions, anxiety disorders)

    • Genetic background

    • Environmental factors

    • Interaction with other neurotransmitter/neuromodulator systems

• Biomarkers and patient selection:

  • Identification of responder populations based on receptor expression or signaling profiles

  • Development of companion diagnostics to predict treatment efficacy