Recombinant Mouse Phosphatidylcholine:ceramide cholinephosphotransferase 2 (Sgms2)

What is the biochemical function of Sgms2 and how does it differ from other sphingomyelin synthases?

Sgms2 (also known as SMS2) is a transferase that regulates the synthesis of sphingomyelin (SM) from ceramide (Cer) . It is one of three sphingomyelin synthase homologues (SMS1, SMS2, and SMSr), but only SMS1 and SMS2 catalyze the production of SM . While SMS1 is primarily responsible for bulk SM production in the Golgi apparatus, SMS2 is found at both the Golgi and plasma membrane . SMSr, in contrast, controls ceramide homeostasis in the endoplasmic reticulum and regulates ceramide phosphoethanolamine synthesis . SMS2's distinct function is particularly evident in its involvement in regulating lipid microdomains, influence on fatty acid transport, and modulation of lipid droplet formation .

What is the subcellular localization of Sgms2 and how does this impact its function?

Wildtype SMS2 primarily localizes to the Golgi apparatus and plasma membrane (PM), distinguishing it from SMS1 (primarily Golgi) and SMSr (primarily ER) . This dual localization is functionally significant, as SMS2 can convert ceramide produced in the outer leaflet of the plasma membrane into SM, dynamically modifying membrane lipid composition . The proper localization of SMS2 depends on an ER export signal containing a conserved IXMP motif, located 13-14 residues upstream of the first membrane span . Pathogenic mutations in this motif (e.g., I62S, M64R) cause retention of SMS2 in the ER, disrupting normal sphingolipid distribution throughout the secretory pathway .

How are Sgms2 knockout mouse models generated?

Sgms2 knockout mouse models are typically generated using homologous recombination in embryonic stem cells. In a specific example from the literature, a targeting vector designed to delete exon 2 of SMS2, containing a cassette encoding β-galactosidase and a neomycin-selectable marker (Nls-lacZ and PGK-neo), was electroporated into mouse D3 embryonic stem cells . Successfully recombined cells were selected using G418 and confirmed via Southern blotting . These cells were then karyotyped to ensure proper chromosome count (2N) before being used to generate chimeric mice. The chimeric mice were subsequently mated with C57BL/6 mice to obtain F1 Sgms2 +/− mice . Recombination events were further confirmed by LA-PCR using tail samples, with specific primers positioned to verify the deletion .

What phenotypes are observed in Sgms2 knockout mice?

Sgms2 knockout mice exhibit several significant phenotypes related to lipid metabolism. Most notably, they show protection against high-fat diet-induced obesity and insulin resistance . In the liver of SMS2 knockout mice, large and mature lipid droplets are scarcely observed, indicating disrupted lipid storage mechanisms . Furthermore, SMS2 deficiency attenuates NFκB activation and reduces atherosclerosis risk, although the detailed mechanisms were not fully described in earlier studies . At the cellular level, SMS2 knockout results in disrupted regulation of lipid microdomain function, which affects key processes including fatty acid transport via CD36/FAT and caveolin 1-associated pathways .

What experimental methods are commonly used to assess Sgms2 expression?

Researchers typically verify Sgms2 expression using several complementary techniques:

• Immunoblot analysis: Using anti-SMS2 or anti-tag (e.g., FLAG, V5) antibodies to detect protein expression levels .

• Fluorescence microscopy: Utilizing fluorescently-tagged antibodies to visualize subcellular localization of SMS2, often co-stained with organelle markers such as calnexin for ER localization .

• Quantitative real-time PCR: Measuring SMS2 mRNA levels to assess gene expression .

• LA-PCR: For genotyping knockout mice using specific primers designed around the deletion site .

• Metabolic labeling: Using clickable sphingolipid analogues (like clickable sphingosine) followed by TLC analysis to assess SMS2 enzymatic activity .

How do pathogenic variants of Sgms2 affect lipid distribution and cellular function?

Pathogenic variants of SMS2, particularly the missense mutations I62S and M64R associated with osteoporosis with cerebral calcifications and dense bones (OP-CDL), cause profound alterations in sphingolipid metabolism and distribution . These mutations disrupt an ER export signal, causing retention of functional SMS2 in the ER rather than its normal localization to the Golgi and plasma membrane .

This mislocalization has several significant consequences:

• Redirected SM synthesis: ER-retained SMS2 variants produce SM in the ER rather than at the Golgi/PM, leading to a wide-ranging perturbation of lipid distributions throughout the secretory pathway .

• Enhanced SM biosynthesis: Patient-derived fibroblasts with these mutations show increased rates of de novo SM biosynthesis .

• Competition with dihydroceramide desaturase: ER-resident pathogenic SMS2 variants compete with ceramide desaturase DES1 for dihydroceramide substrate, resulting in 3-4 fold higher levels of dihydroceramide and dihydroceramide-based SM compared to wildtype cells .

• Altered glycosphingolipid levels: The altered SM synthesis affects the balance with glycosphingolipids, as SMS2 variants have direct access to ER-derived ceramides that would normally feed into other pathways .

These alterations in lipid distribution significantly impact membrane properties along the secretory pathway, likely contributing to the pathological manifestations of OP-CDL .

What molecular mechanisms underlie Sgms2's role in metabolic disorders?

SMS2 plays a critical role in metabolic disorders through several interconnected mechanisms:

• Lipid microdomain regulation: SMS2 modulates sphingomyelin content in lipid microdomains (caveolae), which are small invaginations of plasma membrane important for lipid uptake and glucose homeostasis .

• CD36/FAT and caveolin 1 interaction: SMS2 partially associates with fatty acid transporter CD36/FAT and caveolin 1 (a scaffolding protein of caveolae) in lipid microdomains . This interaction is crucial for coordinated lipid uptake and droplet formation.

• Prevention of lipid droplet formation: SMS2 deficiency prevents the formation of large, mature lipid droplets in hepatocytes. This was demonstrated both in knockout mice and in HepG2 cells treated with SMS2 siRNA .

• Triglyceride accumulation reduction: siRNA targeting SMS2 decreased triglyceride accumulation in the liver of leptin-deficient (ob/ob) mice, directly linking SMS2 to hepatic steatosis .

• Protection against diet-induced obesity: SMS2 knockout mice are protected against high-fat diet-induced obesity and insulin resistance, suggesting a central role in these metabolic disorders .

These mechanisms collectively indicate that SMS2 functions as a dynamic regulator of membrane lipid composition, influencing cellular lipid uptake, storage, and metabolic homeostasis.

What experimental approaches can be used to analyze Sgms2 activity in vitro?

Several sophisticated experimental approaches enable researchers to analyze SMS2 activity in vitro:

• Metabolic labeling with clickable sphingolipid analogues:

  • Cells are treated with clickable sphingosine analogues that incorporate into sphingolipid metabolism

  • After lipid extraction, samples undergo click reactions with fluorogenic dyes (e.g., 3-azido-7-hydroxycoumarin)

  • Analysis by thin-layer chromatography (TLC) reveals conversion of ceramide to sphingomyelin

• Mass spectrometric analysis of sphingolipids:

  • Quantitative analysis of total lipid extracts to measure:

    • Sphingomyelin levels

    • Ceramide species (including dihydroceramide variants)

    • Glycosphingolipid levels

  • This approach can detect specific sphingolipid species (e.g., SM d18:0/16:0)

• Cell line models with controlled SMS2 expression:

  • SMS1/2 double knockout cell lines (ΔSMS1/2)

  • Doxycycline-inducible expression systems for wildtype and mutant SMS2

  • Complementation studies comparing enzyme-dead variants (e.g., D276A mutants)

• Specialized lipid visualization techniques:

  • Fluorescent lipid probes (e.g., LD540 for lipid droplets, NR12A and NR-ER for membrane analysis)

  • Fluorescence microscopy to track changes in lipid distribution

These methods provide complementary approaches to assess SMS2 enzymatic activity, substrate specificity, and the consequences of SMS2 manipulation on cellular lipid composition.

How does Sgms2 contribute to cancer progression, particularly in breast cancer?

SMS2 promotes an aggressive breast cancer phenotype through multiple mechanisms:

• Anti-apoptotic effects: SMS2 promotes cancer cell proliferation by suppressing apoptosis through ceramide-associated pathways . Since ceramide typically promotes apoptosis, SMS2's conversion of ceramide to sphingomyelin may reduce pro-apoptotic signals.

• Enhanced epithelial-to-mesenchymal transition (EMT): SMS2 promotes cancer cell invasiveness by enhancing EMT initiation, a critical process in metastasis .

• TGF-β/Smad signaling activation: SMS2 activates the TGF-β/Smad signaling pathway primarily by increasing TGF-β1 secretion . This mechanism is likely associated with aberrant expression of sphingomyelin, which can affect membrane properties and signaling platform formation.

• Association with metastasis: High SMS2 expression is associated with breast cancer metastasis, suggesting it may serve as a potential prognostic marker .

• Therapeutic potential: Given its roles in cancer progression, SMS2 inhibition may represent a possible anticancer therapy approach for breast cancer .

These findings indicate that SMS2-mediated sphingolipid metabolism is an important factor in breast cancer progression, particularly through its effects on apoptosis resistance and promotion of metastatic potential.

What genetic modification approaches are effective for studying Sgms2 function?

Several genetic modification approaches have proven effective for studying SMS2 function:

• CRISPR/Cas9 gene editing:

  • Used to generate complete SMS2 knockouts in cell lines and animal models

  • Example: SIRT1 KO mel1 hESCs were generated using plasmids containing Cas9, specific gRNA (AGAGATGGCTGGAATTGTCC), and a GFP indicator

  • GFP-positive cells were purified by flow cytometry and subsequently verified by immunofluorescence and sequencing

• siRNA-mediated knockdown:

  • Transient reduction of SMS2 expression

  • Example methodologies include:

    • Transfection with specific siRNAs using lipofection reagents (e.g., Lipofectamine RNAiMAX)

    • Evaluation of knockdown efficiency by qRT-PCR 48 hours post-transfection

    • Demonstrated effects in HepG2 cells and ob/ob mice models

• Retrovirus/lentivirus-based gene transfer:

  • For stable expression of wildtype or mutant SMS2 variants

  • Protocol example:

    • HEK293T cells are co-transfected with target construct and packaging vectors (psPAX2, pMD2.G)

    • Virus-containing medium is harvested, filtered, and used to infect target cells

    • Selection with appropriate antibiotics (e.g., G418 at 1 mg/ml)

    • Verification of expression by immunoblot and functional assays

• Creation of chimeric proteins:

  • Fusion proteins combining domains from different SMS family members

  • Example: SMSr-SMS2 11-77 chimera, where the N-terminal region of SMSr was replaced with the IXMP-containing cytosolic tail of SMS2

  • Such constructs help identify functional domains and trafficking signals

These genetic approaches provide complementary strategies for investigating SMS2 function at multiple levels, from complete knockout to domain-specific analysis.

What are the optimal cell culture conditions for studying Sgms2 function?

For optimal study of SMS2 function, researchers should consider these specific culture conditions:

• Cell line selection:

  • Immortalized mouse embryonic fibroblasts (MEFs) from SMS2 knockout and wildtype mice

  • HeLa or HEK293T cells for heterologous expression studies

  • Specialized cell lines like ZS2 (derived from SMS1/SMS2 double knockout MEFs)

  • Breast cancer cell lines for oncology-focused studies

• Base medium composition:

  • DMEM (high-glucose) supplemented with 10% FBS

  • Additional supplements: 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids

  • For stem cell maintenance: ESGRO Complete Clonal Grade Medium or M10 medium with leukemia inhibitory factor (500 units/ml)

• Serum considerations:

  • When determining SM levels, cells should be cultured in serum-free medium (e.g., OptiPro SFM) to block SM supply from serum

  • This critical step prevents exogenous sphingolipids from confounding experimental results

• Maintenance conditions:

  • Humidified chamber with 5% CO₂ atmosphere

  • Regular passaging to maintain cells at subconfluent densities

  • For mouse stem cells: culture on gelatin-coated plates

• Selection conditions for stable lines:

  • Puromycin, G418 (1 mg/ml), or other appropriate antibiotics based on selection marker

  • Daily medium changes during selection period to remove dead cells

These conditions provide a solid foundation for studying SMS2 function while minimizing experimental variables that might affect sphingolipid metabolism.

What are the key considerations when designing experiments to study Sgms2 and ceramide metabolism?

When designing experiments to study SMS2 and ceramide metabolism, researchers should consider these critical factors:

• Control of sphingolipid precursors:

  • Use serum-free conditions to eliminate exogenous sphingolipid sources when measuring de novo synthesis

  • Consider the impact of cell density on sphingolipid metabolism

  • Account for potential compensatory mechanisms between different sphingolipid metabolic pathways

• Appropriate controls and comparisons:

  • Include enzyme-dead variants (e.g., SMS2 D276A) as negative controls

  • Compare SMS2 with other sphingomyelin synthases (SMS1, SMSr) to distinguish isoform-specific effects

  • Use multiple cell lines to ensure findings aren't cell-type specific

• Lipid analysis methods:

  • Combine complementary approaches (mass spectrometry, TLC, metabolic labeling)

  • Consider sphingolipid pools in different subcellular compartments

  • Use clickable sphingolipid analogs that minimally perturb natural metabolism

• Temporal considerations:

  • Account for acute vs. chronic effects of SMS2 manipulation

  • Design time-course experiments to capture dynamic changes in lipid composition

  • Consider inducible expression systems (e.g., doxycycline-inducible constructs) for temporal control

• Physiological relevance:

  • Validate cell culture findings in appropriate animal models

  • Consider tissue-specific effects of SMS2 manipulation

  • Design experiments that address specific physiological or pathological contexts (obesity, cancer, etc.)

• Data interpretation challenges:

  • Account for potential redistribution vs. net changes in sphingolipid levels

  • Consider feedback mechanisms in sphingolipid metabolism

  • Distinguish direct SMS2 effects from secondary metabolic adaptations

Addressing these considerations will strengthen experimental design and facilitate more meaningful interpretation of results when studying SMS2 function in sphingolipid metabolism.

How can Sgms2 be targeted for potential therapeutic applications in metabolic disorders?

Based on the research findings, SMS2 represents a promising therapeutic target for metabolic disorders through several potential approaches:

• Small molecule inhibitors:

  • Development of specific SMS2 inhibitors could mimic the beneficial metabolic effects seen in knockout models

  • Target validation: SMS2 knockout mice show protection against high-fat diet-induced obesity and insulin resistance

  • Potential applications would include treatment of hepatic steatosis, insulin resistance, and obesity

• siRNA/antisense therapeutics:

  • Transient reduction of SMS2 expression via siRNA showed efficacy in reducing hepatic triglyceride accumulation in ob/ob mice

  • Liver-targeted delivery systems could be developed for hepatic steatosis applications

  • Considerations for delivery, stability, and specificity would be critical for clinical translation

• Modulation of lipid microdomain function:

  • Targeting SMS2's role in regulating lipid microdomains (caveolae) presents an indirect approach

  • This could influence CD36/FAT and caveolin 1-dependent lipid uptake and storage

  • Potential for combination therapies targeting multiple components of these lipid transport systems

• Biomarker development:

  • SMS2 activity or expression levels could serve as biomarkers for metabolic disease risk or progression

  • Sphingolipid profiles might provide diagnostic or prognostic information

  • This would require development of standardized assays for clinical application

• Considerations for therapeutic development:

  • Tissue specificity: Target SMS2 in metabolically relevant tissues (liver, adipose tissue) while minimizing effects elsewhere

  • Safety assessment: Evaluate potential side effects on bone development, immune function, and other SMS2-dependent processes

  • Dosing strategy: Determine whether partial or complete inhibition of SMS2 activity is optimal for therapeutic benefit

The translational potential of SMS2-targeted therapies is supported by multiple lines of evidence from genetic models, but requires further research to address specificity, delivery, and safety considerations.

What is the relationship between Sgms2 and TGF-β/Smad signaling in disease contexts?

SMS2 and TGF-β/Smad signaling exhibit an important relationship with significant implications for disease pathology:

• SMS2 activates TGF-β/Smad signaling:

  • In breast cancer contexts, SMS2 promotes activation of the TGF-β/Smad signaling pathway

  • The primary mechanism involves increased TGF-β1 secretion, which is likely associated with altered sphingomyelin levels in cellular membranes

• Mechanistic interactions:

  • Sphingomyelin, as a major component of lipid microdomains, can affect receptor clustering and signaling platform formation

  • Changes in membrane sphingomyelin composition may alter TGF-β receptor trafficking, stability, or activation

  • Ceramide-sphingomyelin balance could impact second messenger systems that modulate TGF-β signaling

• Implications in cancer progression:

  • In breast cancer, SMS2-mediated activation of TGF-β/Smad signaling enhances epithelial-to-mesenchymal transition (EMT)

  • This promotes cancer cell invasiveness and metastatic potential

  • The pathway represents a potential intervention point for anti-metastatic therapies

• Potential relevance in fibrotic diseases:

  • Given TGF-β's central role in fibrosis, SMS2 might influence fibrotic processes in multiple organs

  • The sphingolipid composition could affect myofibroblast differentiation and extracellular matrix production

  • This suggests potential applications beyond cancer in conditions like liver fibrosis, pulmonary fibrosis, or renal fibrosis

• Research implications:

  • Investigating SMS2-TGF-β crosstalk in different disease contexts may reveal tissue-specific mechanisms

  • Dual targeting of SMS2 and TGF-β signaling components could provide synergistic therapeutic effects

  • Biomarker development could incorporate both sphingolipid profiles and TGF-β pathway activation markers

This relationship between SMS2 and TGF-β signaling represents an important intersection between sphingolipid metabolism and a major growth factor signaling pathway with broad implications for multiple disease processes.

What are common challenges when working with recombinant Sgms2 and how can they be addressed?

Researchers working with recombinant SMS2 frequently encounter several technical challenges that require specific approaches:

• Expression level variability:

  • Challenge: Inconsistent expression levels between experiments or cell lines

  • Solution: Use inducible expression systems (e.g., doxycycline-inducible constructs) for more precise control

  • Verification: Confirm expression levels via immunoblotting and immunofluorescence microscopy before functional assays

• Subcellular localization artifacts:

  • Challenge: Overexpression can cause mislocalization of SMS2

  • Solution: Use epitope-tagged versions (FLAG, V5) with verified localization patterns

  • Validation: Always confirm localization using co-staining with organelle markers (Golgi, plasma membrane, ER)

• Functional redundancy with SMS1:

  • Challenge: Distinguishing SMS2-specific effects from those potentially compensated by SMS1

  • Solution: Use SMS1/SMS2 double knockout backgrounds for clean functional studies

  • Example: The ZS2 cell line provides a system completely lacking endogenous sphingomyelin synthase activity

• Lipid analysis complexity:

  • Challenge: Accurately measuring changes in specific sphingolipid species

  • Solution: Combine multiple analytical approaches (mass spectrometry, TLC with clickable lipids)

  • Control: Include enzyme-dead variants (D276A mutants) as negative controls for activity

• Preservation of membrane domains:

  • Challenge: Maintaining the integrity of lipid microdomains during experimentation

  • Solution: Careful cell lysis conditions and appropriate detergents for biochemical isolation

  • Consideration: Use complementary approaches (microscopy, biochemical fractionation) to verify domain properties

• Off-target effects in genetic models:

  • Challenge: Potential confounding effects in knockout or knockdown models

  • Solution: Use multiple independent lines to minimize line-specific effects

  • Validation: Perform rescue experiments with wildtype SMS2 to confirm phenotype specificity

These technical challenges can be addressed through careful experimental design, appropriate controls, and complementary methodological approaches, enabling more reliable investigation of SMS2 function.

How can researchers distinguish between direct and indirect effects of Sgms2 manipulation?

Distinguishing between direct and indirect effects of SMS2 manipulation requires methodical experimental approaches:

• Temporal analysis:

  • Approach: Use time-course experiments following acute manipulation of SMS2

  • Rationale: Direct effects typically manifest rapidly, while secondary adaptations develop over time

  • Implementation: Employ inducible systems for precisely timed SMS2 expression or inhibition

• Structure-function studies:

  • Approach: Compare wildtype SMS2 with:

    • Enzyme-dead variants (e.g., D276A mutants)

    • Trafficking mutants (e.g., I62S/M64R with altered localization)

    • Domain-specific chimeras (e.g., SMSr-SMS2 fusion proteins)

  • Analysis: Effects seen with enzymatically inactive SMS2 suggest protein-interaction rather than catalytic mechanisms

• Substrate/product manipulation:

  • Approach: Supply exogenous sphingomyelin or manipulate ceramide levels independently

  • Question: Does bypassing SMS2's enzymatic function rescue the phenotype?

  • Control: Compare effects in wildtype and SMS2-deficient backgrounds

• Pathway validation:

  • Approach: Systematically inhibit downstream pathways suspected to mediate SMS2 effects

  • Example: If investigating TGF-β pathway involvement, use TGF-β receptor inhibitors in SMS2-overexpressing cells

  • Interpretation: Blocking a putative mediator should attenuate SMS2 effects if that pathway is required

• Multi-omics integration:

  • Approach: Combine lipidomics with transcriptomics or proteomics

  • Analysis: Identify early molecular changes (potential direct effects) versus later adaptive responses

  • Insight: Map changes onto known pathways to distinguish primary from secondary effects

• In vitro reconstitution:

  • Approach: Reconstitute SMS2 activity in defined membrane systems

  • Advantage: Allows assessment of direct enzymatic effects in isolation from cellular complexity

  • Limitation: May not capture all aspects of in vivo regulation

By systematically applying these approaches, researchers can build a more accurate model of which cellular changes represent direct consequences of SMS2 activity versus secondary adaptations or compensatory responses.

What are emerging areas of Sgms2 research with therapeutic potential?

Several promising research directions for SMS2 show significant therapeutic potential:

• Metabolic disease interventions:

  • Development of SMS2-specific inhibitors for treating obesity, insulin resistance, and fatty liver disease

  • Investigation of tissue-specific targeting strategies to maximize efficacy while minimizing side effects

  • Exploration of the relationship between SMS2 and other metabolic regulators (e.g., SIRT1) to design combination therapies

• Cancer therapeutics:

  • Targeting SMS2 to inhibit breast cancer progression and metastasis through:

    • Disrupting TGF-β/Smad signaling activation

    • Enhancing ceramide-mediated apoptotic signaling

    • Preventing epithelial-to-mesenchymal transition

  • Exploring potential synergies with established chemotherapeutics or immunotherapies

• Bone disorders interventions:

  • Understanding the mechanism by which SMS2 mutations cause osteoporosis with cerebral calcifications (OP-CDL)

  • Developing therapies that correct sphingolipid distribution abnormalities in these disorders

  • Exploring broader implications for bone health and calcium homeostasis

• Sphingolipid-based biomarkers:

  • Developing diagnostic or prognostic biomarkers based on sphingolipid profiles in various diseases

  • Correlating SMS2 activity or expression with disease risk or progression

  • Creating patient stratification approaches for precision medicine applications

• Membrane biology applications:

  • Utilizing SMS2's role in lipid microdomain organization to develop tools for studying and manipulating membrane domains

  • Exploring SMS2-mediated effects on receptor trafficking and signaling platform organization

  • Developing approaches to modulate cellular lipid distribution through targeted SMS2 manipulation

• Interaction with emerging metabolic pathways:

  • Investigating cross-talk between SMS2 and sirtuins (like SIRT1) in metabolic regulation

  • Exploring connections between sphingolipid metabolism and other cellular stress responses

  • Understanding SMS2's role in cellular adaptation to metabolic challenges

These research directions hold promise for developing novel therapeutic strategies for multiple conditions while advancing our fundamental understanding of sphingolipid biology.

What technological advances could enhance research on Sgms2 and sphingolipid metabolism?

Emerging technologies promise to significantly advance SMS2 and sphingolipid metabolism research:

• Advanced imaging technologies:

  • Super-resolution microscopy: Visualizing sphingolipid distribution and SMS2 localization at nanoscale resolution

  • Live-cell sphingolipid probes: Developing non-toxic fluorescent sphingolipid analogs with minimal perturbation of natural metabolism

  • Correlative light and electron microscopy (CLEM): Combining functional imaging with ultrastructural analysis of membrane domains

• Mass spectrometry innovations:

  • Single-cell lipidomics: Analyzing sphingolipid composition at the individual cell level to capture cellular heterogeneity

  • Spatial mass spectrometry: Mapping sphingolipid distribution across tissues with high spatial resolution

  • Flux analysis: Tracking isotope-labeled precursors to measure dynamic changes in sphingolipid metabolism

• CRISPR-based technologies:

  • CRISPRa/CRISPRi systems: Enabling precise temporal control of SMS2 expression without permanent genetic modification

  • Base editors and prime editors: Creating precise point mutations to study structure-function relationships

  • CRISPR screens: Identifying novel regulators and effectors in SMS2 pathways

• Computational approaches:

  • Molecular dynamics simulations: Modeling SMS2 structure, membrane interactions, and substrate binding

  • Systems biology modeling: Integrating sphingolipid metabolism with broader cellular networks

  • Machine learning applications: Predicting functional consequences of SMS2 variants or identifying potential inhibitors

• Organoid and microphysiological systems:

  • Tissue-specific organoids: Studying SMS2 function in physiologically relevant 3D tissue models

  • Organ-on-chip platforms: Examining sphingolipid metabolism in complex multicellular environments

  • Patient-derived models: Testing personalized interventions based on individual sphingolipid profiles

• Single-molecule techniques:

  • Single-molecule enzymology: Measuring SMS2 kinetics and dynamics at the individual molecule level

  • Optical tweezers and nanopore analysis: Studying SMS2-membrane interactions and substrate processing

  • Proximity labeling approaches: Identifying transient interaction partners of SMS2 in different cellular compartments