Recombinant Mouse Probable G-protein coupled receptor 62 (Gpr62)

What is Gpr62 and where is it expressed in the mouse CNS?

Gpr62 (G protein-coupled receptor 62) is an orphan G protein-coupled receptor that shows highly selective expression in mature oligodendrocytes within the central nervous system (CNS). Transcriptional profiling has identified Gpr62 as one of the most oligodendrocyte-enriched transcripts in the brain, showing equivalent enrichment to established myelin proteins such as Myelin oligodendrocyte glycoprotein (MOG), Myelin basic protein (MBP), and Proteolipid protein (PLP) . Expression appears to be restricted primarily to mature (MOG+) stages of the oligodendrocyte lineage, distinguishing it from other GPCRs involved in earlier stages of differentiation. Outside the CNS, Gpr62 expression has been detected in the testes but shows very limited expression elsewhere in the body .

For experimental verification of expression patterns, in situ RNA hybridization can be performed on fixed tissue from different CNS regions. Researchers commonly use DIG-labeled antisense probes for Gpr62, generated from plasmids encoding the mouse Gpr62 coding sequence . qPCR with specific primers (e.g., TTTATCCTGGCGGTTCTCGTA and TGCGCTAAGTAGAAGGCATCTTG) can also be used to quantify relative expression levels compared to housekeeping genes like 18S ribosomal RNA .

What is the molecular classification of Gpr62?

Gpr62 is classified as a class A (rhodopsin-like) G protein-coupled receptor. It is structurally related to the serotonin 5-HT receptor family, although direct binding of biogenic amines to Gpr62 has not been demonstrated . Gpr62 and the closely related Gpr61 form a distinct subgroup within the class A GPCR superfamily.

Research indicates that both Gpr61 and Gpr62 can form complexes with the melatonin MT2 receptor and modulate its activity, despite showing no binding affinity for melatonin themselves . This suggests potential roles in receptor heterodimerization and modulation of signaling cascades, which is a common feature among certain GPCR subfamilies.

What approaches can be used to study Gpr62 expression during oligodendrocyte development?

Several complementary approaches can be employed to characterize Gpr62 expression during oligodendrocyte development:

• Transcriptional profiling: RNA-seq or microarray analysis of purified oligodendrocyte lineage cells at different developmental stages can track Gpr62 expression changes during maturation. Available data suggests Gpr62 appears predominantly at mature (MOG+) stages .

• Single-cell RNA sequencing: This provides higher resolution of expression patterns across heterogeneous oligodendrocyte populations and developmental trajectories.

• In situ hybridization: DIG-labeled antisense probes for Gpr62 can be used on tissue sections from different developmental timepoints to visualize spatial and temporal expression patterns .

• Quantitative PCR: Using specific primers for Gpr62 (as mentioned above) to measure expression levels across developmental timepoints .

• Immunohistochemistry: Though challenging due to limited availability of specific antibodies, viral expression of tagged Gpr62 (as discussed in the research) can be used to visualize protein localization in different developmental contexts .

For accurate developmental staging, correlation with established oligodendrocyte lineage markers (PDGFRα for OPCs, CNP for immature oligodendrocytes, and MOG/MBP for mature myelinating oligodendrocytes) is essential.

What genetic models have been developed to study Gpr62 function?

The primary genetic model developed to study Gpr62 function is a knockout mouse strain lacking the Gpr62 gene. The generation of this model involved several methodical steps:

• Vector construction: A region encompassing the coding region and most of the 3′ untranslated region (UTR) of mouse Gpr62 (mm10 chr9:106,464,426-106,466,226) was cloned into a targeting vector (pEZ-Frt-lox-DT) .

• Homologous recombination: A 5 kb 5′ arm and a 3 kb 3′ arm were cloned into the NotI and XhoI sites, respectively, to enable targeting via homologous recombination in E14 embryonic stem (ES) cells .

• ES cell screening: Targeted ES cells were screened using Southern blots to confirm homologous recombination of the NeoR-loxP-Gpr62-loxP allele .

• Chimera generation: Successfully targeted ES cell clones were injected into C57BL/6 N embryos to generate chimeric founders and achieve germline transmission of the NeoR-loxP-Gpr62-loxP allele .

• Removal of selection cassette: The mice were crossed with FlpER strain mice to remove the Frt-flanked neomycin resistance cassette, generating a Gpr62 Floxed line .

• Global deletion: The floxed line was crossed with a ubiquitous Meox2-Cre line to drive germline deletion of Gpr62, resulting in a complete knockout allele .

This knockout model enables investigation of the developmental and physiological roles of Gpr62 in oligodendrocyte development and myelination. The floxed allele also provides the opportunity for conditional deletion studies in specific cell types or at defined developmental stages.

How can Gpr62 subcellular localization be determined in vivo?

Determining the subcellular localization of Gpr62 in vivo presents challenges due to limited availability of specific antibodies. Researchers have addressed this through AAV-mediated expression of tagged Gpr62 in oligodendrocytes:

• Viral vector construction: A vector (pAAV-pMBP-Gpr62-Flag) was generated by replacing the eGFP coding sequence in a control vector with the coding region of mouse Gpr62 fused to a C-terminal Flag tag .

• Cell-specific promoter: The vector utilized an MBP (myelin basic protein) promoter to ensure oligodendrocyte-specific expression .

• Viral packaging: The constructed vectors were packaged as AAV2 by specialized viral core facilities .

• In vivo delivery: Viral particles can be delivered through stereotaxic injection into white matter tracts or through intrathecal or intraventricular administration.

• Tissue processing and immunostaining: After appropriate expression time, tissues are fixed, sectioned, and immunostained using antibodies against the Flag tag and markers for different myelin compartments.

Using this approach, researchers determined that virally expressed Gpr62 protein is selectively localized to the adaxonal myelin layer (the innermost layer of myelin adjacent to the axon), suggesting a potential role in axo-myelinic signaling . This localization pattern provides valuable insights into the potential function of Gpr62 in mediating communication between oligodendrocytes and axons.

What techniques are effective for assessing myelination in Gpr62 knockout models?

Multiple complementary techniques are essential for comprehensive assessment of myelination in Gpr62 knockout models:

Despite expectations based on its adaxonal localization, the application of these techniques to Gpr62 knockout mice revealed normal oligodendrocyte numbers and apparently normal myelination within the CNS during both postnatal development and adulthood . This surprising result suggests that Gpr62 may have subtle, compensated, or context-dependent functions in myelination.

What does Gpr62 knockout reveal about its role in developmental myelination?

Studies of Gpr62 knockout mice have provided unexpected insights into its role in developmental myelination:

• Normal oligodendrocyte development: Despite the selective expression of Gpr62 in mature oligodendrocytes, knockout mice display normal numbers of oligodendrocytes throughout the CNS, indicating that Gpr62 is not essential for oligodendrocyte differentiation or survival .

• Normal myelin structure: Electron microscopy analysis revealed that myelin appears structurally normal in Gpr62 knockout mice, with appropriate thickness and compaction .

• Normal myelin protein expression: Western blot analysis of myelin proteins (MBP, PLP, MOG) showed no significant differences between wildtype and knockout animals, indicating normal myelin production .

• No behavioral phenotype: Gpr62 knockout mice show no overt behavioral abnormalities that would suggest myelin dysfunction .

• Functional redundancy with other GPCRs expressed in oligodendrocytes

• A role in subtle aspects of myelin regulation not detected by standard assays

• A context-dependent function that becomes apparent only under specific conditions (e.g., during remyelination or injury)

• Involvement in signaling pathways that can be compensated by alternative mechanisms

How might Gpr62's adaxonal localization relate to its potential function?

The selective localization of Gpr62 to the adaxonal layer of myelin (the innermost myelin layer directly adjacent to the axon) is highly significant and provides important clues about its potential functional roles:

• Axo-myelinic signaling: The adaxonal compartment is a critical interface for bidirectional communication between axons and oligodendrocytes. GPCRs in this location could detect axonally-derived signals that regulate myelin maintenance or adaptation .

• Activity-dependent myelination: Recent research has established that neuronal activity can influence myelination. As a GPCR positioned at the axoglial interface, Gpr62 could potentially transduce activity-dependent signals from axons to oligodendrocytes .

• Metabolic support: Oligodendrocytes provide metabolic support to axons through the adaxonal compartment. Gpr62 might be involved in regulating the metabolic coupling between oligodendrocytes and neurons.

• Myelin refinement: Even though initial myelination appears normal in knockout mice, Gpr62 could play a role in the fine-tuning or refinement of myelin in response to neural circuit activity or other physiological signals.

The apparent dispensability of Gpr62 for normal myelination despite this strategic localization suggests that:

• Its function may be compensated by other signaling mechanisms

• It may serve as a "reserve" signaling system activated only under specific physiological or pathological conditions

• It could mediate subtle aspects of axo-myelinic communication that weren't detected in the studies performed

What is known about the signaling mechanisms of Gpr62?

Knowledge about the specific signaling mechanisms of Gpr62 remains limited, but several aspects can be inferred from its classification and related research:

• G-protein coupling: As a class A (rhodopsin-like) GPCR, Gpr62 likely couples to heterotrimeric G proteins, though the specific G protein subtypes (Gαs, Gαi/o, Gαq/11, Gα12/13) it preferentially activates remain to be determined .

• Relationship to other oligodendrocyte GPCRs: Other oligodendrocyte-expressed GPCRs like Gpr17 and Gpr37 signal through Gαi/o proteins to regulate cAMP levels and influence myelination . By analogy, Gpr62 might utilize similar signaling mechanisms, though possibly with different functional outcomes due to its expression in mature rather than developing oligodendrocytes.

• Receptor interactions: Research indicates that Gpr62 and the related Gpr61 can form complexes with the melatonin MT2 receptor and modulate its activity . This suggests Gpr62 may function as part of receptor heterocomplexes, potentially expanding its signaling capabilities.

• Orphan receptor status: The endogenous ligand(s) for Gpr62 remain unknown, which significantly hampers detailed characterization of its signaling pathways . Based on structural similarity to serotonin receptors, researchers have investigated whether biogenic amines might activate Gpr62, but direct binding has not been demonstrated .

Further research is needed to:

• Identify the endogenous ligand(s) for Gpr62

• Determine its G-protein coupling specificity

• Characterize downstream signaling pathways

• Investigate potential receptor heterocomplexes in oligodendrocytes

What approaches could identify endogenous ligands for orphan Gpr62?

Identifying endogenous ligands for orphan GPCRs like Gpr62 presents significant challenges but can be approached through multiple complementary strategies:

• Reverse pharmacology screening:

  • Generate cell lines stably expressing Gpr62 coupled to reporter systems (e.g., calcium flux, cAMP, β-arrestin recruitment)

  • Screen tissue extracts, particularly from brain and cerebrospinal fluid

  • Fractionate active extracts using chromatography to isolate candidate ligands

  • Confirm activity using synthetic versions of candidate molecules

• Structural bioinformatics approaches:

  • Homology modeling based on Gpr62's relationship to serotonin receptors

  • Virtual screening of compound libraries against the predicted binding pocket

  • Molecular docking simulations with candidate ligands

  • Experimental validation of top computational hits

• Proximity-based labeling:

  • Express Gpr62 fused to proximity labeling enzymes (BioID, APEX2)

  • Identify proteins that interact with Gpr62 in its native environment

  • This might reveal not only ligands but also signaling partners

• Transcriptional response profiling:

  • Compare gene expression changes in wildtype versus Gpr62 knockout oligodendrocytes

  • Identify signaling pathways dysregulated in the absence of Gpr62

  • Use pathway analysis to infer potential upstream ligands

• Candidate-based approach:

  • Given Gpr62's adaxonal localization, focus on axonally-derived molecules

  • Test neurotransmitters, neuropeptides, growth factors, and other axonally-secreted molecules

  • Investigate if Gpr62 might respond to components of the extracellular matrix or myelin

• Melatonin signaling investigation:

  • Since Gpr62 can form complexes with melatonin MT2 receptors , investigate whether melatonin-related compounds might indirectly activate Gpr62-containing receptor complexes

The identification of Gpr62's endogenous ligand(s) would significantly advance understanding of its physiological role and potentially reveal new mechanisms of axo-glial communication.

How might Gpr62 function differ under pathological conditions versus normal development?

While Gpr62 appears dispensable for normal CNS myelination , its function may become more critical under pathological conditions:

• Demyelinating diseases:

  • In multiple sclerosis or other demyelinating conditions, Gpr62 might play a role in remyelination that differs from its role in developmental myelination

  • Stress signals or inflammatory mediators absent during normal development might serve as ligands for Gpr62 during disease

  • The unique challenges of remyelination versus developmental myelination could reveal context-dependent functions

• Response to axonal injury:

  • Following axonal injury, signals transmitted across the adaxonal interface might activate Gpr62-mediated pathways

  • Gpr62 could participate in the oligodendrocyte response to axonal degeneration

  • Potential role in oligodendrocyte survival decisions following loss of axonal contact

• Aging-related myelin dysfunction:

  • Age-related changes in myelin stability might reveal roles for Gpr62 not apparent during development

  • Accumulation of damage or stress over time could unmask phenotypes not seen in young Gpr62 knockout mice

• Metabolic stress conditions:

  • Under metabolic challenge (e.g., hypoxia, glucose deprivation), Gpr62 might mediate adaptive responses in oligodendrocytes

  • Potential role in regulating metabolic support from oligodendrocytes to axons under stress conditions

Experimental approaches to investigate these possibilities include:

• Inducing demyelination in Gpr62 knockout mice (e.g., cuprizone, lysolecithin, EAE models)

• Aging studies comparing wildtype and Gpr62 knockout mice

• Axonal injury models (e.g., optic nerve crush) in knockout versus wildtype backgrounds

• Metabolic challenge experiments in ex vivo slice cultures from knockout and control animals

Such studies might reveal that Gpr62 serves as a "reserve" signaling system activated primarily under stress or pathological conditions rather than during normal development.

What experimental approaches could reveal potential redundancy with other GPCRs?

The apparent dispensability of Gpr62 for normal myelination despite its specific adaxonal localization suggests potential functional redundancy with other signaling systems. Several experimental approaches could address this possibility:

Through these approaches, researchers might uncover subtle or redundant functions of Gpr62 that are masked in conventional knockout models by compensatory mechanisms.

What conditional genetic models would advance understanding of Gpr62 function?

While the global Gpr62 knockout has provided valuable insights , more sophisticated genetic models would enable deeper investigation of its functions:

• Cell type-specific conditional knockouts:

  • Oligodendrocyte-specific deletion using Cnp-Cre or Sox10-CreERT2 with Gpr62-floxed alleles

  • This would eliminate potential confounds from Gpr62 expression in other cell types

  • Temporal control with inducible Cre systems would distinguish developmental versus maintenance roles

• Temporally controlled knockout models:

  • Using tamoxifen-inducible CreERT2 systems to delete Gpr62 at specific developmental stages

  • This approach could reveal time-dependent functions masked by developmental compensation

  • Particularly valuable for distinguishing roles in initial myelination versus myelin maintenance

• Reporter knock-in models:

  • Generate Gpr62-GFP or Gpr62-CreERT2 knock-in lines to precisely map expression

  • Would enable purification of Gpr62-expressing cells for molecular profiling

  • Useful for lineage tracing studies to understand the developmental trajectory of Gpr62+ cells

• Overexpression/gain-of-function models:

  • Transgenic lines with controlled overexpression of Gpr62 in oligodendrocytes

  • Could reveal functions not apparent in loss-of-function models

  • Particularly informative if combined with identification of activating ligands

• Humanized Gpr62 models:

  • Replace mouse Gpr62 with human GPR62 to study potential species differences

  • Would enhance translational relevance of findings

  • Could be combined with human-specific pharmacological tools

• Tagged knock-in models:

  • Generate mice expressing Gpr62 with small epitope tags from the endogenous locus

  • Would enable precise localization studies without overexpression artifacts

  • Could include proximity labeling tags (BioID, APEX2) for in vivo interaction studies

• Signaling pathway reporter mice:

  • Cross Gpr62 knockout or overexpression mice with reporter lines for relevant signaling pathways

  • Examples include cAMP sensors, calcium indicators, or pathway-specific transcriptional reporters

  • Would provide direct readouts of Gpr62's influence on downstream signaling

These genetic tools would provide more nuanced understanding of Gpr62 function beyond what can be determined from conventional knockout models.

How might high-throughput screening approaches advance Gpr62 research?

High-throughput screening (HTS) approaches could significantly accelerate Gpr62 research in several key areas:

• Ligand discovery:

  • Development of cell-based assays using Gpr62 coupled to various readout systems:

    • GPCR activation reporters (β-arrestin recruitment, calcium flux, cAMP modulation)

    • Bioluminescence resonance energy transfer (BRET) assays

    • Transcriptional reporters downstream of relevant G-protein pathways

  • Screening of:

    • Compound libraries (100,000+ small molecules)

    • Peptide libraries

    • Lipid libraries (given the potential interaction with myelin components)

    • Fractionated tissue extracts from brain

• Functional modulators:

  • Identify compounds that:

    • Act as agonists, antagonists, or allosteric modulators of Gpr62

    • Influence Gpr62 trafficking or receptor complex formation

    • Modulate interactions with specific G-proteins

  • These tools would enable precise temporal control of Gpr62 function in experimental systems

• Signaling pathway mapping:

  • CRISPR-based screens to identify genes that:

    • Modify Gpr62 signaling

    • Compensate for Gpr62 loss

    • Synergize with Gpr62 in oligodendrocyte function

  • Phosphoproteomic screens to map signaling networks activated downstream of Gpr62

• Transcriptional response profiling:

  • RNA-seq of oligodendrocytes following modulation of Gpr62 activity

  • Comparison across multiple timepoints to identify immediate early versus delayed responses

  • Integration with epigenomic data to understand transcriptional regulation mechanisms

• Drug repurposing screens:

  • Testing libraries of clinically approved drugs for effects on Gpr62 activity

  • Could identify compounds with potential for rapid translation to clinical applications

  • Focus on compounds known to cross the blood-brain barrier

A comprehensive high-throughput screening approach would generate valuable molecular tools for Gpr62 research and potentially identify new therapeutic targets for demyelinating diseases or other conditions involving oligodendrocyte dysfunction.

What experimental approaches could determine Gpr62's role in myelin maintenance versus initial myelination?

Distinguishing between roles in initial myelination versus long-term myelin maintenance requires specific experimental designs:

• Temporally controlled gene deletion:

  • Use inducible Cre-loxP systems (e.g., Sox10-CreERT2; Gpr62fl/fl) to delete Gpr62 specifically after developmental myelination is complete

  • Tamoxifen administration in adult mice after myelination is complete (typically >P60 in mice)

  • Comprehensive assessment of myelin ultrastructure, composition, and stability over extended timeframes (6-18 months post-deletion)

• Aging studies:

  • Compare age-related changes in myelin in wildtype versus Gpr62 knockout mice

  • Detailed analysis of myelin in aged mice (18-24 months)

  • Focus on parameters associated with myelin maintenance: paranode stability, myelin outfoldings, remyelination efficiency

• Stress challenge paradigms:

  • Subject wildtype and Gpr62 knockout mice to stressors that challenge myelin maintenance:

    • Dietary manipulations (cuprizone at sub-demyelinating doses)

    • Social stress paradigms

    • Metabolic challenges

  • Assess recovery and long-term consequences of these challenges

• Remyelination models:

  • Induce focal demyelination (lysolecithin, ethidium bromide) in adult wildtype and Gpr62 knockout mice

  • Compare efficiency and quality of remyelination

  • This tests the hypothesis that Gpr62 may have distinct roles in developmental myelination versus repair

• Live imaging approaches:

  • Utilize in vivo imaging (2-photon microscopy) of fluorescently labeled myelin in wildtype and Gpr62 knockout backgrounds

  • Track myelin sheath dynamics over extended periods

  • Would enable detection of subtle defects in myelin stability or remodeling

• Molecular turnover studies:

  • Use pulse-chase labeling of myelin components to assess turnover rates

  • Compare stability and replacement rates of myelin proteins and lipids in the presence or absence of Gpr62

  • Could reveal subtle defects in myelin homeostasis not apparent in static analyses

These approaches would help determine whether Gpr62's adaxonal localization reflects a role in ongoing communication between mature oligodendrocytes and axons that is important for long-term myelin maintenance rather than initial myelination.

What are the optimal methods for expressing and purifying recombinant Gpr62 protein?

Production of high-quality recombinant Gpr62 protein presents specific challenges common to membrane proteins, requiring tailored approaches:

• Expression systems:

  • Mammalian cells (HEK293, CHO): Provide proper post-translational modifications and folding machinery for GPCRs

    • Transient transfection with codon-optimized Gpr62 constructs

    • Stable cell lines for consistent production

  • Insect cells (Sf9, Hi5): Often yield higher expression levels than mammalian systems

    • Baculovirus-mediated expression

    • Consider addition of N-terminal signal sequences to enhance membrane targeting

  • Cell-free systems: Can be optimized for membrane protein production with added lipids or nanodiscs

• Construct optimization:

  • Addition of N-terminal tags (His6, FLAG, etc.) for purification

  • Consideration of C-terminal tags (note that based on the research, C-terminal FLAG tags have been successfully used with Gpr62)

  • Fusion partners to enhance expression (T4 lysozyme, BRIL, thermostabilized apocytochrome b562)

  • Removal of flexible regions that may hinder crystallization (if structural studies are planned)

• Solubilization and purification:

  • Careful selection of detergents (DDM, LMNG, digitonin) for extraction from membranes

  • Two-step affinity purification using tags

  • Size exclusion chromatography to ensure monodispersity

  • Consider native nanodiscs or SMALPs (styrene maleic acid lipid particles) for detergent-free extraction

• Stabilization strategies:

  • Addition of lipids during purification to maintain native-like environment

  • Use of stabilizing ligands (once identified)

  • Application of conformational thermostabilization approaches (alanine scanning)

• Quality control:

  • Circular dichroism to confirm secondary structure

  • Thermal stability assays

  • Negative stain electron microscopy to assess homogeneity

  • Functional validation using binding assays once ligands are identified

This methodological framework provides a starting point for producing recombinant Gpr62 for biochemical, structural, and ligand-binding studies. The optimal approach may need refinement based on the specific experimental requirements and the challenging nature of GPCR expression and purification.

How can researchers effectively model and predict Gpr62 structure and ligand binding?

In the absence of experimental structures, computational approaches offer valuable insights into Gpr62 structure and potential ligand interactions:

• Homology modeling:

  • Template selection based on sequence similarity to Gpr62

    • Focus on class A GPCRs with known structures

    • Special consideration for serotonin receptors given Gpr62's structural relationship

  • Multiple template approaches to improve model quality

  • Refinement through molecular dynamics simulations

  • Validation using established structural assessment tools (PROCHECK, Verify3D)

• Binding pocket identification and characterization:

  • Computational mapping of potential ligand binding sites

  • Analysis of conserved motifs across related receptors

  • Molecular dynamics simulations to identify transient pockets

  • Assessment of pocket druggability

• Virtual screening approaches:

  • Structure-based virtual screening against the predicted binding site

    • Docking of compound libraries (ZINC, DrugBank)

    • Pharmacophore-based screening

  • Ligand-based approaches if related receptors have known ligands

    • Similarity searching

    • Machine learning models trained on related GPCR ligands

• Molecular dynamics simulations:

  • Long-timescale simulations to sample conformational space

  • Analysis of receptor dynamics in membrane environment

  • Investigation of potential activation mechanisms

  • Identification of allosteric binding sites

• Integration with experimental data:

  • Refinement of models based on mutagenesis data

  • Iterative approach combining computational predictions with experimental validation

  • Incorporation of cross-linking or spectroscopic constraints if available

• Advanced computational approaches:

  • AI-based structure prediction (AlphaFold2, RoseTTAFold)

  • Enhanced sampling techniques (metadynamics, replica exchange)

  • Free energy calculations to estimate binding affinities

These computational approaches can guide experimental work by generating testable hypotheses about Gpr62 structure, function, and potential ligands, particularly valuable given the orphan status of this receptor.

What are the key considerations for developing Gpr62 antibodies for research applications?

Development of specific antibodies against Gpr62 presents particular challenges that require strategic approaches:

• Antigen design strategies:

  • Extracellular domain peptides: Target unique regions of the N-terminus or extracellular loops

    • Advantage: Accessible in intact cells

    • Challenge: Often short and may share homology with related GPCRs

  • Intracellular domain peptides: Target C-terminus or intracellular loops

    • Advantage: Often more divergent between related GPCRs

    • Challenge: Not accessible for live-cell applications

  • Recombinant protein fragments: Express soluble domains for immunization

    • Advantage: Larger antigens with potentially more epitopes

    • Challenge: Proper folding may be difficult to achieve

• Production approaches:

  • Monoclonal antibodies: Generate through hybridoma technology

    • Advantage: Consistent reagent with single epitope specificity

    • Challenge: Time-consuming development process

  • Polyclonal antibodies: Immunize animals with Gpr62 antigens

    • Advantage: Multiple epitopes recognized, potentially stronger signals

    • Challenge: Batch-to-batch variation, potential cross-reactivity

  • Recombinant antibodies: Phage display or similar technologies

    • Advantage: No animals required, reproducible reagent

    • Challenge: Technical complexity in development

• Validation requirements:

  • Specificity testing:

    • Western blotting comparing wildtype versus Gpr62 knockout tissues

    • Immunohistochemistry on Gpr62 knockout tissues as negative controls

    • Testing on cells overexpressing Gpr62 versus related GPCRs

  • Application-specific validation:

    • Separate validation for each application (WB, IHC, IP, FACS)

    • Demonstration of expected expression pattern in oligodendrocytes

    • Confirmation of adaxonal localization pattern if used for immunoEM

• Alternative approaches:

  • Tagged Gpr62 expression: As used in the research, expressing Flag-tagged Gpr62 via AAV vectors

    • Advantage: Reliable detection with validated anti-tag antibodies

    • Challenge: Not suitable for endogenous protein detection

  • Nanobodies/single-domain antibodies: Smaller antibody fragments

    • Advantage: Better tissue penetration, potential for intracellular expression

    • Challenge: Complex development process

• Critical controls:

  • Always include Gpr62 knockout tissue as negative control

  • Include cells expressing known levels of recombinant Gpr62 as positive controls

  • Pre-adsorption controls with immunizing peptides

Development of well-validated Gpr62 antibodies would significantly advance research by enabling more precise localization studies and biochemical analyses of the endogenous protein, addressing a key limitation in the current research tools.