High-affinity G protein-coupled receptor for activated thrombin, stimulating phosphoinositide hydrolysis. It plays a significant role in platelet activation.
Mouse F2rl2 (Proteinase-activated receptor 3/PAR3) belongs to the protease-activated receptor family, a subfamily of seven transmembrane G protein-coupled cell surface receptors. The protein contains an extracellular N-terminus with a thrombin cleavage site, seven transmembrane domains, and an intracellular C-terminus involved in signal transduction .
Methodological approach: When investigating F2rl2 structure-function relationships, researchers should employ sequence alignment tools to compare mouse and human orthologs, focusing on the N-terminal domain where proteolytic activation occurs. Expression constructs should include the complete coding sequence (Cys29-Leu705) to maintain functional integrity .
F2rl2 functions as a cofactor in thrombin-mediated cleavage and activation of PAR4 (F2RL3). Upon activation by proteolytic cleavage of its extracellular amino terminus, the newly exposed amino terminus acts as a tethered ligand that activates the receptor . This activation triggers phosphoinositide hydrolysis and subsequent signaling cascades through G-protein coupled pathways .
Methodological considerations: To study F2rl2 signaling, researchers should implement:
Calcium mobilization assays to detect intracellular calcium flux
Phosphoinositide hydrolysis measurements
Co-expression systems with PAR4 to assess cofactor activity
G-protein coupling analysis using GTPγS binding assays
Recent research has identified a regulatory axis involving long non-coding RNA NEAT1, which acts as a sponge for miR-582-5p that directly targets F2rl2. In myocardial infarction models, NEAT1 and F2rl2 are highly expressed while miR-582-5p is downregulated .
Methodological approach: For investigating F2rl2 expression regulation:
Use the validated primers shown in Table 1 for precise qRT-PCR quantification
Employ dual-luciferase reporter assays to verify miRNA binding sites
Implement RNA immunoprecipitation to confirm RNA-protein interactions
Utilize gain/loss-of-function approaches with shRNA or overexpression vectors
| Target gene | Forward primers, 5′-3′ | Reverse primers, 5′-3′ |
|---|---|---|
| mmu-F2RL2 | GCCAGTCACTGTTTGCCAAAG | CCAGCCCTCTATGTCAGAAAGT |
| hsa-F2RL2 | GCAAAGCCAACCTTACCCATT | GAGGTAGATGGCAGGTATCAGT |
Recombinant F2rl2 production requires consideration of proper folding and post-translational modifications essential for functionality.
Methodological approach: Based on available data, researchers should consider:
Mammalian expression systems (HEK293 cells) for proper folding and glycosylation
E. coli systems for producing specific domains (with limitations on functionality)
C-terminal tagging strategies (6-His tag) to facilitate purification without disrupting the critical N-terminal region
Serum-free formulations for applications requiring carrier-free preparations
When expressing F2rl2, verify protein integrity through Western blot analysis using validated antibodies (e.g., ab40769, Abcam, 1:500 dilution) .
For accurate detection and quantification of F2rl2:
Methodological recommendations:
RNA extraction using standardized protocols followed by qRT-PCR with validated primers (see Table 1)
Protein detection via Western blot using RIPA lysis solution for extraction, followed by BCA protein quantification
Load 20 μg protein per lane with GAPDH (ab181602, 1:5000) as loading control
For tissue samples, develop standardized collection and processing protocols to minimize degradation
F2rl2 participates in several important signaling networks:
| Pathway Name | Pathway Related Proteins |
|---|---|
| Neuroactive ligand-receptor interaction | AGTR1A, DRD1A, TBXA2R, GRIK4, GABRG1, GCGR, P2RX4, TAAR14E, NPY8BR, HTR6 |
Methodological approach: For pathway analysis, researchers should:
Implement phosphoproteomic analysis to identify phosphorylation cascades
Use specific pathway inhibitors to delineate signaling branches
Perform co-immunoprecipitation to identify direct protein interaction partners
Consider systems biology approaches to map comprehensive signaling networks
F2rl2 plays a significant role in myocardial infarction (MI) pathology. Downregulation of F2rl2 has been shown to ameliorate left ventricular function, reduce infarct area, and decrease cell apoptosis in MI mouse models .
Methodological approach for MI studies:
Establish MI mouse models following standardized surgical procedures
Assess cardiac function via echocardiography, measuring left ventricular ejection fraction (EF) and fractional shortening (FS)
Evaluate infarct size using triphenyltetrazolium chloride and Evans blue staining
For in vitro studies, implement oxygen-glucose deprivation models using human cardiac myocytes
The regulatory network involving NEAT1, miR-582-5p, and F2rl2 has emerged as an important mechanism in myocardial infarction:
Methodological approach:
NEAT1 acts as a molecular sponge for miR-582-5p, which targets F2rl2
Silencing NEAT1 increases miR-582-5p levels and decreases F2rl2 expression
Validation requires dual-luciferase reporter assays to confirm direct interactions
Gain/loss-of-function studies should manipulate each component of the axis individually
Developing selective F2rl2 modulators presents several challenges:
Methodological considerations:
The high structural similarity between PAR family members requires precise targeting
The unique activation mechanism involving proteolytic cleavage complicates traditional drug design approaches
Species differences between mouse and human orthologs must be considered for translational research
Both orthosteric (binding at the active site) and allosteric (binding at secondary sites) approaches should be explored
Validation requires demonstrating specificity against other PAR family members
For functional studies of F2rl2:
Methodological approach:
For knockdown experiments, use validated shRNA approaches as demonstrated in MI studies
Include appropriate controls (e.g., shNC) in all experiments
For overexpression studies, consider inducible systems to control expression levels
In vivo delivery can be achieved through lentiviral vectors injected directly into target tissues
Phenotypic assessment should include both molecular markers and functional outcomes