Recombinant Mouse Receptor expression-enhancing protein 6 (Reep6)

What is REEP6 and what is its primary function in the retina?

REEP6 belongs to the Receptor Expression Enhancer Protein family that influences the structure of the endoplasmic reticulum (ER). It is highly expressed in rod photoreceptor cells and plays a critical role in maintaining ER homeostasis and trafficking of essential phototransduction proteins . REEP6 appears to be involved in regulating ER membrane structure, as demonstrated by the increased ER volume observed in photoreceptors lacking REEP6 . Additionally, it modulates the expression of multiple proteins in the phototransduction cascade, including rhodopsin, guanylate cyclase 1 (GC1), and guanylate cyclase 2 (GC2) .

What isoforms of REEP6 are expressed in the retina?

Research has confirmed the expression of a retina-specific isoform, REEP6.1, which is distinct from other isoforms . This was verified using 3D organoid optic cups to investigate REEP6 expression. The REEP6.1 isoform is specifically affected by certain frameshift mutations identified in patients with retinitis pigmentosa . When designing experiments involving REEP6, researchers should consider which isoforms they are targeting and verify isoform-specific effects.

What genetic mutations in REEP6 are associated with retinitis pigmentosa?

Multiple pathogenic variants in REEP6 have been identified in individuals with autosomal recessive retinitis pigmentosa from unrelated families. These include:

• Three frameshift variants

• Two missense variants (c.383C>T [p.Pro128Leu] and c.404T>C [p.Leu135Pro])

• A genomic rearrangement that disrupts exon 1

• A recurrent variant c.268G>C identified in Chinese patients with autosomal recessive retinitis pigmentosa

Expression studies of these variants in cultured cells suggest that the missense mutations and the REEP6.1 frameshift mutation destabilize the protein . Researchers investigating REEP6 should consider screening for these known pathogenic variants when studying patient populations.

How is REEP6 localized in rod photoreceptors?

Immunostaining studies show that REEP6 is predominantly expressed in rod photoreceptors, primarily distributed in the inner segments . This localization pattern is consistent with its proposed role in ER function and protein trafficking within photoreceptors. When performing immunohistochemistry studies on retinal tissue, researchers should expect to see REEP6 signals mainly in the inner segments of rod photoreceptors.

What methodologies are most effective for generating Reep6 knockout mouse models?

Several research groups have successfully generated Reep6 knockout mouse models using CRISPR/Cas9 gene editing. Key methodological approaches include:

Targeting Strategy 1:

• Design gRNAs targeting intron 1 and exon 5 of Reep6.1

• Screen for deletion of the sequence between target sites using PCR with primers F1 (5' AGACAAGCAGGACTGCCTTG3') and R2 (5' CTATACAATCCCTCCCAGAG3')

• Verify by sequencing

• Genotype the mutant allele using primer pair F1 and R2 (505 bp PCR product)

• Genotype the WT allele using primer pair F1 and R1 (5'CTGCACTCACGAAGCATATGC3'), yielding a 295 bp PCR product

Targeting Strategy 2:

• Target exon 4 of Reep6

• Use non-homologous end joining repair to create an insertion mutation

• Generate mice with a 1 bp insertion in exon 4 that results in a frameshift

• Backcross founders to create C57BL/6J congenic lines

Validation of knockout should include both genomic verification and protein expression analysis using immunohistology and western blotting to confirm the absence of REEP6 in homozygous knockout mice .

How can researchers effectively measure the impact of REEP6 deficiency on photoreceptor function?

Multiple complementary approaches have been used to comprehensively assess the functional impact of REEP6 deficiency:

• Electroretinography (ERG): Full-field ERG of dark-adapted Reep6-/- mice can evaluate photoreceptor function. Measure both a-wave (photoreceptor response) and b-wave (rod bipolar cell response) amplitudes. In Reep6-/- mice, significant reductions in scotopic responses have been observed as early as P20 .

• Histological assessment: Paraffin-embedded sections (5 μm thickness) stained with H&E can be used to quantify the number of nuclei rows in the outer nuclear layer across different positions of the retina .

• Ultrastructural analysis:

  • Serial block-face scanning electron microscopy (3View)

  • Transmission electron microscopy (TEM)

  • 3D reconstruction models of the ER to assess morphological changes

• Molecular analysis:

  • Western blotting for phototransduction proteins (rhodopsin, GC1, PDE6B, GRK1)

  • Immunohistochemistry to assess protein localization and trafficking

  • ATP measurements using ADP-GLO Max Assay kit (Promega)

• ER stress markers:

  • Immunostaining for C/EBP homologous protein (CHOP)

  • Caspase-12 activation assessment

What experimental approaches can distinguish between the functions of different REEP6 isoforms?

To investigate isoform-specific functions of REEP6:

• Expression constructs: Generate coding sequences of different REEP6 isoforms (e.g., REEP6.1) combined with tags (e.g., HA tag) cloned into expression vectors such as pcDNA3.1 .

• Isoform-specific mutations: Create constructs with mutations that specifically affect certain isoforms, such as the frameshift mutation that specifically affects the REEP6.1 isoform .

• 3D organoid optic cups: These can be used to investigate isoform-specific expression patterns in a model that recapitulates retinal development .

• Rescue experiments: Perform rescue experiments with different isoforms in REEP6 knockout backgrounds to determine which isoforms can compensate for specific functions.

• RNA analysis: Use isoform-specific primers for RT-PCR to analyze expression patterns of different isoforms in various retinal cell types and developmental stages.

How does REEP6 regulate the trafficking of phototransduction proteins?

REEP6 plays a critical role in the trafficking of essential phototransduction proteins. Research approaches to study this function include:

• Immunolocalization studies: In Reep6 null mice, both GC1 and GC2 proteins were undetectable in the outer segments compared to controls. PDE6 showed increased immunoreactivity in the inner segments rather than proper localization to the outer segments .

• Expression analysis: Western blotting of retinal proteins using antibodies against rhodopsin, GC1, PDE6B, GRK1, and other phototransduction proteins .

• Cell culture models: Expression of recombinant REEP6 in cell lines such as COS-7 cells revealed effects on ER and Golgi morphology, with diminished ER volume and reduced Golgi volume .

• Protein interaction studies: While not explicitly mentioned in the search results, co-immunoprecipitation and proximity ligation assays could identify direct interactions between REEP6 and trafficking components.

The current data suggests that REEP6 modulates the expression and trafficking of multiple proteins in the phototransduction cascade, with GC1 and GC2 being most severely affected in Reep6 knockout mice .

What explains the discrepancy between increased mitochondrial numbers but decreased ATP levels in REEP6-deficient photoreceptors?

This apparent contradiction in REEP6-deficient photoreceptors represents an interesting research question. Several hypotheses have been proposed:

• Mitochondrial dysfunction: Despite increased numbers, mitochondria in REEP6-deficient photoreceptors may not function properly, possibly due to compromised protein expression from the ER .

• Inflammation and ROS: RNA-seq revealed upregulation of several complement factors in Reep6 mutant retina, indicating inflammation. Inflammation increases reactive oxygen species (ROS) production, which can inhibit mitochondrial function .

• Altered lipid metabolism: ER plays an important role in lipid metabolism, and ER stress may affect lipid metabolism and cut the lipid supply for mitochondria. Since fatty acids are major fuel sources for photoreceptor mitochondria, this could reduce ATP production despite increased mitochondrial numbers .

To investigate this phenomenon, researchers could:

• Measure mitochondrial membrane potential

• Assess oxygen consumption rate and extracellular acidification rate

• Analyze expression of mitochondrial proteins

• Measure lipid metabolism markers

• Quantify ROS levels in REEP6-deficient versus control photoreceptors

How does REEP6 modulate ER and Golgi morphologies?

REEP6 appears to play a significant role in shaping ER and Golgi structures:

• Effects on ER:

  • Ultrastructural analysis by electron microscopy followed by 3D reconstruction revealed expanded ERs in rod photoreceptors lacking REEP6

  • In COS-7 cells expressing recombinant REEP6, diminished calnexin (an ER marker) signals were observed, suggesting reduced ER volume or faster ER turnover

  • REEP6 knockout mice showed a significant increase in the area of the ER near the base of the outer segment

• Effects on Golgi:

  • REEP6 expression in COS-7 cells resulted in reduced Golgi volume and caused Golgi dispersal

  • Abnormal Golgi was observed in Reep6 mutant photoreceptors, with Golgi appearing in the outer nuclear layer of the mutant retina, but not in wild-type controls

Experimental approaches to study these effects include:

• Immunostaining for ER and Golgi markers

• 3D reconstruction of serial EM sections

• Live cell imaging of tagged ER and Golgi proteins

• Expression of REEP6 variants in cell culture models

What control conditions should be included in REEP6 research?

When designing experiments involving REEP6, researchers should consider the following controls:

• Genetic controls: Include wild-type (+/+), heterozygous (+/-), and homozygous (-/-) animals for comparison in knockout studies .

• Age-matched controls: Age-matching is crucial as REEP6 knockout mice show progressive degeneration. For example, ERG responses have been measured at P20, 2 months, and 4 months of age to track progression .

• Cell type specificity: Since REEP6 is predominantly expressed in rod photoreceptors, cone-specific markers and responses can serve as internal controls .

• Expression constructs: When studying REEP6 variants, include both wild-type REEP6 and empty vector controls in expression studies .

• Temporal considerations: Examine phenotypes at early timepoints (e.g., P20) before degeneration becomes too advanced to distinguish primary from secondary effects .

What are appropriate expression systems for studying recombinant REEP6?

Several expression systems have been successfully used to study REEP6:

• Mammalian cell lines: COS-7 cells have been used to express recombinant REEP6 for studying effects on ER and Golgi morphology .

• Expression vectors:

  • pEGFP-N1 plasmid with EGFP fused to the C-terminus of REEP6.1

  • pcDNA3.1 vector with HA-tagged REEP6 (both wild-type and mutant forms)

• Cloning methods:

  • NEBuilder has been used for cloning mouse full-length Reep6.1 cDNA

  • Commercial synthesis of coding sequences combined with tags is another approach

• 3D organoid models: Human 3D organoid optic cups have been used to investigate REEP6 expression and confirm isoform-specific expression .

When designing expression constructs, researchers should consider:

• Whether to use N- or C-terminal tags

• The size and type of tag (EGFP, HA, etc.)

• The promoter driving expression

• The species origin of the REEP6 sequence (mouse vs. human)

• Which isoform to express (e.g., REEP6.1)

How can researchers effectively assess ER stress in REEP6-deficient models?

To evaluate ER stress in REEP6-deficient models, researchers have employed several complementary approaches:

• ER stress markers: Immunostaining for C/EBP homologous protein (CHOP), which is a downstream pro-apoptotic target of PERK and IRE1 pathways .

• ER stress-induced apoptosis: Detection of activation of Caspase-12, an ER stress-induced apoptosis marker .

• Ultrastructural analysis: Examination of ER morphology using electron microscopy and 3D reconstruction to identify structural changes .

• Gene expression analysis: Although not explicitly mentioned in the search results, qPCR or RNA-seq to analyze expression of UPR pathway genes (e.g., BiP, CHOP, XBP1 splicing) would be valuable.

• Protein analysis: Western blotting for ER stress markers and UPR pathway components.

These assessments should ideally be performed at early timepoints (e.g., P20) before major phenotypic defects develop to distinguish primary from secondary effects .

What are the recommended protocols for histological assessment of REEP6 knockout retinas?

Based on the research literature, the following protocol has been effective for histological assessment:

• Tissue fixation:

  • Fix mouse eyeballs in 4% paraformaldehyde prepared in 1xPBS at room temperature for 24 hours

  • Remove cornea and lens

• Processing:

  • Dehydrate eyecup in increasing concentrations of ethanol (30% to 100%)

  • Infiltrate with paraffin followed by embedding

• Sectioning:

  • Section paraffin blocks at 5 μm thickness

• H&E staining:

  • De-paraffinize by heating slides at 60°C for one hour followed by washing with xylene

  • Stain with hematoxylin and eosin

• Analysis:

  • Count rows of nuclei in the outer nuclear layer at several different positions across the whole section

For immunohistochemistry:

• Use retina-specific antibodies (e.g., against rhodopsin, GC1, PDE6B, GRK1, and REEP6)

• Assess protein localization, especially in inner and outer segments

What is the most effective CRISPR/Cas9 design strategy for generating REEP6 knockout mice?

Based on published research, two effective CRISPR/Cas9 strategies have been employed:

Strategy 1 - Deletion of multiple exons:

• Design two gRNAs:

  • gRNA1 (5'GTCTCAAAGAGGAGGAAGAGG3') targeting intron 1

  • gRNA2 (5'GGTTCCGATGTTGATGCTGGG3') targeting exon 5

• This approach removes exons 2-4 and part of exon 5, deleting approximately two-thirds of the coding region and affecting both REEP6.1 and REEP6.2 isoforms .

Strategy 2 - Frameshift mutation:

• Target exon 4 of Reep6

• Use non-homologous end joining repair to create a 1 bp insertion

• This results in a frameshift of the open reading frame

Both approaches have successfully generated viable Reep6 knockout mice with retinal phenotypes. Verification of knockout should include genomic PCR, sequencing, and protein expression analysis by immunoblotting and immunohistochemistry.

What is the optimal method for analyzing subcellular localization of phototransduction proteins in REEP6 models?

To effectively analyze subcellular localization of phototransduction proteins in REEP6 models:

• Immunohistochemistry:

  • Use dark-adapted retinas (e.g., at P20)

  • Employ specific antibodies against key phototransduction proteins (GC1, GC2, PDE6, CNGB1)

  • Compare localization between knockout and control retinas

  • Focus on inner segment vs. outer segment distribution

• Subcellular fractionation:

  • Although not explicitly described in the search results, biochemical fractionation of retinal tissue would allow quantitative assessment of protein distribution between subcellular compartments

• High-resolution imaging:

  • Confocal microscopy for co-localization studies

  • Super-resolution microscopy techniques for detailed subcellular localization

• Electron microscopy:

  • Immunogold labeling combined with electron microscopy for ultrastructural localization

Previous studies have shown that in Reep6 null mice, GC1 and GC2 proteins were undetectable in the outer segments, while PDE6 showed increased inner segment localization compared to normal outer segment localization .

What are the most promising therapeutic approaches for REEP6-associated retinitis pigmentosa?

While the search results don't directly address therapeutic approaches, several potential strategies could be considered based on the pathophysiology of REEP6-associated retinitis pigmentosa:

• Gene therapy: Delivering functional copies of REEP6 to photoreceptors using adeno-associated viral vectors, particularly targeting the rod-specific REEP6.1 isoform.

• ER stress modulators: Since REEP6 deficiency leads to ER stress and subsequent apoptosis, compounds that alleviate ER stress could potentially slow disease progression.

• Protein trafficking enhancers: Molecules that promote correct trafficking of phototransduction proteins like GC1 and GC2 might compensate for REEP6 deficiency.

• Mitochondrial function support: Given the mitochondrial abnormalities in REEP6-deficient photoreceptors, approaches that support mitochondrial function might be beneficial.

• Cell-based therapies: Transplantation of photoreceptor precursors or stem cell-derived photoreceptors could potentially replace degenerating cells.

Future research should include pre-clinical testing of these approaches in Reep6 knockout mouse models, with functional assessment by ERG and structural evaluation by histology and OCT.

How might the function of REEP6 differ from other REEP family members in specialized cells?

REEP6 belongs to the REEP/Yop1 family of proteins that influence ER structure, but its specific role in rod photoreceptors suggests unique functions:

• Cell type specificity: Unlike other REEP family members, REEP6 shows high specificity for rod photoreceptors .

• Isoform specificity: REEP6 has a retina-specific isoform (REEP6.1) that appears to have specialized functions in photoreceptors .

• Protein trafficking: REEP6 seems particularly important for trafficking of specific phototransduction proteins (GC1, GC2, PDE6), which may be a specialized function not shared by other REEP family members .

• ER-Golgi interaction: REEP6 affects both ER and Golgi morphology, suggesting a role in the ER-Golgi interface that may be tailored to the high protein trafficking demands of photoreceptors .

• Fertility impact: Male Reep6 knockout mice are sterile, suggesting additional roles in male reproductive tissue .

Comparative studies between different REEP family members in photoreceptors and other specialized cells would help elucidate the unique functions of REEP6.