Recombinant Mouse SURP and G-patch domain-containing protein 2 (Sugp2), partial
Description
Research Applications and Experimental Validation
Recombinant Sugp2 has been critical in:
Functional Studies in Spermatogenesis
Protein Interaction Mapping
Antibody Development
-
Rabbit polyclonal antibodies against recombinant Sugp2 fragments show reactivity at 1:2,000 dilution in Western blotting .
-
Validated in cell lines (HEK293T, HeLa) and mouse testis lysates .
Production and Quality Control
Recombinant mouse Sugp2 is typically produced using:
Stability:
Key Research Findings
-
Splicing Regulation: Sugp2 deficiency alters splicing patterns in 1,214 genes, primarily those involved in energy metabolism .
-
Chromatin Association: Proteomic analysis identified Sugp2 as a chromatin-bound protein during spermatocyte development (Figure 1C in ).
-
Evolutionary Conservation: 89% sequence similarity between mouse and human Sugp2, suggesting conserved RNA regulatory roles .
Experimental Protocols Using Recombinant Sugp2
Western Blotting
| Parameter | Specification |
|---|---|
| Antibody dilution | 1:1,000–1:2,000 |
| Blocking buffer | 3% non-fat dry milk in TBST |
| Detection | ECL with 5s exposure |
Primer Design for Sugp2 Studies
| Primer Name | Sequence (5’→3’) |
|---|---|
| Sugp2-Transcript1-F | AAACCCAAGGACATGGAGTTT |
| Sugp2-Transcript1-R | CTATTTGGCCCGCTTGT |
| Sugp2-KO-R | CTGCCCTTATCTATGACGCTATGG |
Product Specs
Please note: We will prioritize shipping the format we currently have in stock. However, if you have any specific requirements for the format, please specify them when placing your order. We will then prepare the product according to your request.
Note: All of our proteins are shipped with standard blue ice packs by default. If you require dry ice shipping, please inform us in advance. Additional fees will apply.
Generally, the shelf life of liquid form is 6 months at -20°C/-80°C. The shelf life of lyophilized form is 12 months at -20°C/-80°C.
Target Background
Q&A
What functional domains of Sugp2 are critical for its role in mRNA alternative splicing, and how can their activity be experimentally validated?
Sugp2 contains two conserved domains: SURP (found in splicing regulators) and G-patch (associated with RNA processing). To validate their activity:
-
Method: Clone SURP (aa 150–300) and G-patch (aa 400–500) domains into expression vectors for in vitro splicing assays. Use CRISPR-Cas9 to delete these domains in germ cells and perform RNA sequencing to compare splicing events (e.g., SE, MXE) .
-
Key Data:
How can researchers resolve contradictions between Sugp2’s molecular impact (e.g., 5,427 altered splicing events) and its minimal phenotypic effect on fertility?
Methodological Approach:
-
Perform combinatorial knockout studies with homologs (e.g., Sugp1) to assess functional redundancy .
-
Use single-cell RNA-seq to identify compensatory pathways in Sugp2 −/− germ cells.
-
Validate splicing isoforms via nanopore long-read sequencing to detect truncated/non-functional proteins.
Data Insight:
| Parameter | WT Testis | Sugp2 −/− Testis |
|---|---|---|
| Splicing Events | 2,112 SE | 3,673 SE (+74%) |
| Fertility Rate | 98% | 95% (no significant difference) |
| Source: Spermatogenesis and fertility assays . |
What experimental designs are optimal for studying Sugp2’s interaction with splicing regulators like PTBP2?
Strategy:
-
Use co-immunoprecipitation (Co-IP) with phosphorylated PTBP2 mutants to map interaction interfaces.
-
Employ in vitro phosphomimetic assays (e.g., Ser178Asp mutation) to test RNA-binding affinity changes .
-
Critical Controls: Include Sugp1-deficient cells to rule out cross-reactivity.
Interaction Data:
How does Sugp2 regulate energy metabolism pathways during spermatogenesis?
Mechanistic Approach:
-
Conduct metabolomic profiling (e.g., ATP/ADP ratios) in Sugp2 −/− germ cells.
-
Use chromatin immunoprecipitation (ChIP-seq) to identify Sugp2-bound loci near metabolic genes (e.g., Atp5a1, Slc39a14) .
Key Findings:
What are the limitations of current in vitro models for studying Sugp2’s chromatin-associated functions?
Critical Analysis:
-
Nuclear localization of Sugp2 is stage-specific (enriched in pachytene spermatocytes), making in vitro germ cell cultures insufficient for mimicking in vivo chromatin dynamics .
-
Solution: Use testicular organoids or stage-synchronized in vivo models combined with CUT&RUN for chromatin occupancy profiling.
How do tissue-specific isoforms of Sugp2 influence its regulatory networks?
Experimental Design:
-
Compare brain vs. testis isoforms via nanopore sequencing and isoform-specific knockdown.
-
Key Insight: Brain isoforms lack exon 5, altering SURP domain topology and RNA-binding specificity .
