Recombinant Mouse Transmembrane protein 182 (Tmem182)

What is the basic structure of the Tmem182 protein?

Tmem182 encodes a novel 229 amino acid protein with a calculated molecular mass of 25,845 Da. Kyte-Doolittle analysis of the protein sequence identifies four putative membrane-spanning regions, confirming its integral membrane topology. The protein contains a conserved region (amino acids 52-62) within a large extracellular loop that is critical for its function. Homologs of Tmem182 are found across various species, with the mouse protein sharing high amino acid identity with human (90%), dog (87%), rat (87%), and chick (71%) variants .

What is the tissue distribution pattern of Tmem182?

Tmem182 shows a distinctive tissue-specific expression pattern. Analysis across a panel of 10 murine tissues revealed highest expression in white adipose tissues (WAT), with 10-fold to 20-fold higher levels than in brown adipose tissue (BAT). Additionally, Tmem182 is specifically expressed in skeletal muscle. In genetically obese (ob/ob) mice, Tmem182 transcript levels are approximately 3-fold upregulated in BAT compared to wild-type C57BL/6 mice . Both skeletal muscle and heart also express Tmem182, suggesting its importance across multiple muscle types .

How should researchers generate experimental constructs for Tmem182 studies?

For plasmid construction, researchers should amplify the Tmem182 coding sequence (reference sequence for mouse: NM_001081198) from cDNA by PCR. The PCR product can be cloned into appropriate expression vectors (e.g., pcDNA3.1 for cellular studies). For recombinant protein expression with epitope tags, researchers can insert tags such as HA (YPYDVPDYA) with flexible glycine linkers at the C-terminus using PCR-based strategies. For lentiviral expression, the coding sequence can be cloned into vectors like pWPXL between appropriate restriction sites (e.g., BamHI and EcoRI). Successful construction should be confirmed by restriction enzyme digestion and DNA sequencing .

How is Tmem182 expression regulated during cellular differentiation?

Tmem182 expression is dramatically upregulated during both adipogenesis and myogenesis. In 3T3-L1 adipocytes, Tmem182 transcript levels are approximately 2500-fold higher than in preadipocytes, with significant increases first noted at day 3 post-induction (157-fold increase). This pattern is consistent across multiple adipogenesis models, including ScAP-23 cells (75-fold increase) and primary cultures of murine stromal vascular fraction cells (22-fold increase). In myogenesis using the C2C12 model, Tmem182 transcript is markedly upregulated during myoblast to myotube conversion, with a 10-fold increase one day post-induction and approximately 770-fold higher levels at 7 days post-myogenic induction .

What transcription factors regulate Tmem182 expression?

Tmem182 is regulated at the transcriptional level by the myogenic regulatory factor MyoD1. Studies using dual-luciferase reporter assays have identified the promoter region of the Tmem182 gene, and chromatin immunoprecipitation assays have confirmed MyoD1's role in regulating Tmem182 transcription. This regulation helps explain the tissue-specific expression pattern of Tmem182 in muscle cells .

How do inflammatory factors affect Tmem182 expression?

TNFα treatment of 3T3-L1 adipocytes results in a dramatic ~90% decrease in Tmem182 transcript levels. This suggests that Tmem182 expression is responsive to inflammatory signaling, which may have implications for understanding its role in pathological conditions involving inflammation, such as muscular dystrophies or obesity-related inflammation in adipose tissue .

What are the effects of Tmem182 on muscle development and regeneration?

Tmem182 functions as a negative regulator of myogenic differentiation and muscle regeneration. In vivo studies indicate that Tmem182 induces muscle fiber atrophy and delays muscle regeneration. Conversely, Tmem182 knockout in mice leads to significant increases in body weight, muscle mass, muscle fiber number, and muscle fiber diameter. Skeletal muscle regeneration is also accelerated in Tmem182-knockout mice, suggesting that Tmem182 normally acts to restrain these processes .

How does Tmem182 affect cardiac differentiation?

Tmem182 inhibits myocardial differentiation of human induced pluripotent stem cells (hiPSCs). Studies using doxycycline-inducible TMEM182 overexpression showed that while TMEM182 did not affect the differentiation of hiPSCs into mesoderm (as evidenced by unchanged expression of BrachyuryT and MESP1), it significantly suppressed their differentiation into cardiac progenitor cells and cardiomyocytes. This was demonstrated by decreased expression of TBX5, GATA4 (CPC markers), and TNNT2 and MYH6 (cardiomyocyte markers). Immunostaining with α-actinin further showed reduced cardiac sarcomere structure in TMEM182-overexpressing cells .

What cellular mechanisms are affected by Tmem182 manipulation?

Tmem182 affects several cellular processes critical for muscle development:

How does Tmem182 interact with integrin beta 1 (ITGB1)?

Tmem182 directly interacts with integrin beta 1 (ITGB1), an essential membrane receptor involved in cell adhesion and muscle formation. This interaction requires specific protein domains: an extracellular hybrid domain of ITGB1 (amino acids 387-470) and a conserved region (amino acids 52-62) within the large extracellular loop of Tmem182. This interaction can be studied using co-immunoprecipitation, mass spectrometry, glutathione-S-transferase pull-down assays, and protein purification techniques .

What signaling pathways are modulated by Tmem182?

Tmem182 modulates ITGB1 activation by coordinating the association between ITGB1 and laminin and regulating the intracellular signaling of ITGB1. Myogenic deletion of Tmem182 increases the binding activity of ITGB1 to laminin and induces the activation of the FAK-ERK and FAK-Akt signaling axes during myogenesis. These pathways are critical for cell adhesion, migration, and differentiation processes in muscle development .

How can researchers experimentally study Tmem182-mediated signaling?

Researchers should employ multiple complementary approaches to study Tmem182 signaling:

• Transwell migration and cell wound healing assays to assess cell motility effects

• Cell adhesion assays to quantify ITGB1-ECM interactions

• GST pull-down and protein purification to identify direct protein interactions

• RNA immunoprecipitation to assess RNA-binding activities

• Western blotting to monitor activation of downstream pathways (phosphorylation of ERK, Akt, p38, JNK)

• Analysis of the activation status of ITGB1 using conformation-specific antibodies

What are the optimal in vitro models for studying Tmem182 function?

Multiple in vitro models are suitable for Tmem182 research, depending on the specific aspect being studied:

When designing experiments, researchers should consider the differentiation stage, as Tmem182 expression varies dramatically throughout the differentiation process .

How can Tmem182 knockout or overexpression models be generated?

For Tmem182 knockout in mice, the CRISPR/Cas9 genome-editing system has been successfully employed. Researchers should design sgRNAs (e.g., sgRNA1: CGATGTTCTTAGTCTCAACGAGG and sgRNA2: ACTAGATGAAACCGTAGGTGTGG) to delete critical exons (such as exons 2-3). The sgRNAs can be inserted into vectors like px459, and the purified construct can be injected into fertilized eggs. Successful knockout should be validated by PCR amplification with Tmem182-specific primers.

For overexpression studies, lentiviral vectors carrying the Tmem182 coding sequence can be injected into target tissues like gastrocnemius muscle. For inducible expression, doxycycline-inducible systems have been successfully employed for temporal control of Tmem182 expression .

What parameters should be measured when assessing muscle phenotypes in Tmem182 studies?

When analyzing muscle phenotypes in Tmem182 gain- or loss-of-function studies, researchers should quantify:

• Cross-sectional area (CSA) of individual muscle fibers

• Muscle fiber diameter

• Total muscle fiber number

• Muscle mass relative to body weight

• Muscle regeneration rate following injury

• Expression of myogenic markers (MyoD, myogenin, MHC)

• Activation status of ITGB1 and downstream signaling components

Images should be acquired from multiple non-overlapping fields (at least five per section) to ensure representative sampling. Software like NIS-Elements BR or ImageJ can be used for quantification of morphological parameters .

What are the technical challenges in producing functional recombinant Tmem182?

Production of functional recombinant Tmem182 presents several challenges due to its transmembrane nature. Researchers need to consider:

• Expression system selection: Mammalian expression systems may be preferable for proper folding and post-translational modifications

• Solubilization strategies: Appropriate detergents for membrane protein extraction

• Purification approaches: Affinity tags should be positioned to avoid interfering with functional domains

• Functional validation: Assays to confirm that the recombinant protein retains its native interactions with partners like ITGB1

• Storage conditions: Stabilization of the purified protein to maintain its conformation and activity

How might Tmem182 research contribute to understanding muscle diseases?

Given its role as a negative regulator of muscle development and regeneration, Tmem182 research may have implications for various muscle diseases:

• Muscular dystrophies: Inhibition of Tmem182 might enhance muscle regeneration

• Sarcopenia: Understanding Tmem182's role in age-related muscle atrophy

• Cardiac disorders: Given its inhibitory effect on cardiac differentiation, Tmem182 modulation might impact cardiac regeneration

• Metabolic disorders: Its expression in adipose tissue suggests potential roles in obesity and insulin resistance

The interaction with ITGB1 is particularly relevant, as integrin signaling is crucial for muscle function and is often dysregulated in muscle diseases .

What are promising approaches for therapeutic targeting of Tmem182?

Based on current knowledge, several approaches for therapeutic targeting of Tmem182 show promise:

• Antisense oligonucleotides or siRNAs to downregulate Tmem182 expression

• Small molecule inhibitors that disrupt the Tmem182-ITGB1 interaction

• Peptide mimetics targeting the conserved region (aa 52-62) of Tmem182

• CRISPR-based approaches for tissue-specific knockout

• Enhancing pathways normally suppressed by Tmem182, such as FAK-ERK and FAK-Akt signaling