Recombinant Mouse Transmembrane protein 198 (Tmem198)

What is Transmembrane protein 198 (Tmem198)?

Transmembrane protein 198 (Tmem198) is a previously uncharacterized seven-transmembrane protein that functions as a membrane scaffold protein specifically activating LRP6 in the Wnt signaling pathway. It plays a critical role in promoting LRP6 phosphorylation by recruiting casein kinase family proteins to this receptor. Tmem198 is essential for proper Wnt-mediated neural crest formation, antero-posterior patterning, and particularly engrailed-2 expression during embryogenesis . This protein represents an important molecular component in developmental processes through its regulatory function in canonical Wnt signaling.

What are the structural characteristics of Tmem198?

Tmem198 is characterized as a seven-transmembrane protein with specific functional domains. The protein contains a cytoplasmic domain that is critical for its ability to recruit casein kinase family proteins to LRP6. Research indicates that the intracellular domain is particularly important for its function, as demonstrated by domain-swapping experiments where the intracellular domain of LRP6 conferred Tmem198 responsiveness to a chimeric LRP5-6 protein . The protein's structure facilitates its membrane-scaffolding function, allowing it to serve as an organizing center for signaling complexes at the cell membrane where it coordinates the phosphorylation of LRP6 by kinases.

How does Tmem198 differ from related transmembrane proteins?

While Tmem198 functions in Wnt signaling through LRP6 activation, other transmembrane proteins have distinct roles. For example, Tmem198B (a pseudogene) is highly expressed in glioma tissues and promotes lipid metabolism reprogramming in glioma progression . In contrast, Tmem18 is associated with obesity regulation through the central nervous system, with germline loss resulting in weight gain and hypothalamic overexpression causing weight loss . Tmem123 serves as a maturation marker in dendritic cells and may be associated with cell surface expression of CD40 . These functional differences highlight the specialized roles of different transmembrane proteins despite structural similarities.

How does Tmem198 specifically activate the Wnt signaling pathway?

Tmem198 specifically activates the canonical Wnt signaling pathway by promoting LRP6 phosphorylation. Experimental evidence shows that Tmem198 selectively cooperates with LRP6 but not with the closely related LRP5 receptor. This specificity is determined by the intracellular domain of LRP6, as demonstrated by experiments where the chimeric protein (LRP5-6) with the intracellular domain of LRP6 could be activated by Tmem198 at levels comparable to native LRP6 . The mechanism involves Tmem198 associating with LRP6 and recruiting casein kinase family proteins via its cytoplasmic domain to phosphorylate key residues important for LRP6 activation, subsequently leading to β-catenin accumulation and activation of Wnt target genes like axin2 and cyclin D1 .

What is the mechanism behind Tmem198's selective interaction with LRP6?

Tmem198 selectively cooperates with LRP6 but not LRP5, despite their structural similarities. The specificity of this interaction depends on the intracellular domain of these receptors. When the intracellular domain of LRP5 was replaced with that of LRP6, the resulting chimeric protein (LRP5-6) became responsive to Tmem198 activation at levels comparable to native LRP6 . Additionally, constitutively active LRP6ΔE1-4 was further activated by Tmem198, while the constitutively active form of LRP5 (LRP5ΔN) remained unresponsive . These findings indicate that specific recognition elements within the LRP6 intracellular domain are crucial for the Tmem198-LRP6 interaction, representing a key regulatory mechanism in Wnt signaling specificity.

What is the interdependence between Tmem198 and casein kinases?

Epistatic analysis has revealed that Tmem198 and casein kinases are interdependent in the phosphorylation of LRP6 . Tmem198 associates with LRP6 and recruits casein kinase family proteins via its cytoplasmic domain to phosphorylate key residues important for LRP6 activation. In mammalian cells, Tmem198 has been shown to be required for both Wnt signaling and casein kinase 1-induced LRP6 phosphorylation . This interdependence suggests that Tmem198 likely functions as a membrane scaffold that facilitates the proximity and orientation of kinases to efficiently phosphorylate LRP6, thus promoting signaling complex formation and pathway activation.

What molecular techniques are optimal for cloning and expressing recombinant mouse Tmem198?

For cloning and expressing recombinant mouse Tmem198, researchers should consider PCR amplification from cDNA with specific primers followed by subcloning into appropriate expression vectors. Based on similar approaches used for related transmembrane proteins, PCR can be performed with a high-fidelity polymerase using the following cycling conditions: initial denaturation at 94°C for 45 seconds, annealing at 60°C for 1 minute, and extension at 72°C for 1 minute . The amplified product can be subcloned into vectors such as pEGFP-C1 or pCMV-HA for mammalian expression, with sequence verification to confirm correct insertion. For cell transfection, reagents like FuGENE 6 have shown efficacy with transmembrane proteins, using a 6-hour transfection period followed by 18 hours of culture before experimental assays .

What cell models are most appropriate for studying Tmem198 function?

Based on previous research with transmembrane proteins, several cell models are suitable for studying Tmem198 function. HEK293T cells have been successfully used to assess Tmem198's role in β-catenin accumulation and Wnt target gene expression . For specialized applications, COS-1 and HeLa cells have demonstrated successful expression of transmembrane proteins after transfection . For immune-related studies, dendritic cell lines like DC2.4 can be transfected using specialized systems such as the Dendritic Cell Nucleofector Solution . When studying developmental aspects, Xenopus embryonic models provide valuable insights into Tmem198's role in neural patterning and embryogenesis, as maternal and zygotic tmem198 mRNAs are widely distributed in the ectoderm and mesoderm during Xenopus embryogenesis .

What are effective approaches for Tmem198 loss-of-function studies?

For effective Tmem198 loss-of-function studies, RNA interference techniques have proven successful. Based on approaches used for human TMEM198, siRNA targeting specific sequences can be employed. Example target sequences that could be adapted for mouse studies include those successfully used for human TMEM198: siRNA-1 (GCGTGCAACTGATGCGGAT) and siRNA-2 (GCCCATCAAACGCTTCAAT) . For stable knockdown, shRNA with targets such as GCTGTTTGTTTGGAGTCGTCT has been effective . When designing siRNAs for mouse Tmem198, researchers should ensure target specificity by confirming sequence conservation between human and mouse orthologs. For in vivo studies, CRISPR-Cas9 technology could be employed to generate knockout models, targeting early exons to ensure complete loss of function.

Is Tmem198 implicated in any pathological conditions?

While Tmem198 itself has not been directly linked to specific pathologies in the provided research, its pseudogene TMEM198B has been implicated in disease. TMEM198B is highly expressed in glioma tissues and cell lines, where it promotes malignant progression through lipid metabolism reprogramming and immune microenvironment remodeling . TMEM198B has been shown to promote PLAGL2 expression by mediating H3K4me3 of PLAGL2 through binding to SETD1B. The increased PLAGL2 then transcriptionally activates ACLY and ELOVL6 expression, enhancing de novo lipogenesis and fatty acid acyl chain elongation in glioma cells . Additionally, TMEM198B promotes macrophage lipid accumulation and fatty acid oxidation through glioma-derived exosomes, inducing M2 polarization of macrophages and facilitating immune escape of glioma cells .

How does Tmem198 expression correlate with developmental stages?

Tmem198 expression patterns correlate with specific developmental stages and processes. In Xenopus embryogenesis, maternal and zygotic tmem198 mRNAs show a widespread distribution in the ectoderm and mesoderm, suggesting roles in early patterning events . The temporal and spatial expression of Tmem198 appears to be regulated to coordinate with specific developmental milestones, particularly those involving Wnt signaling. This coordination is essential for proper neural crest formation and antero-posterior patterning . Researchers studying developmental expression patterns should consider both protein and mRNA detection methods, as post-transcriptional regulation may affect protein levels independently of mRNA abundance. Quantitative RT-PCR, in situ hybridization, and immunohistochemistry at different developmental stages would provide comprehensive insights into the dynamic expression patterns of Tmem198 during embryogenesis.

What protein interaction partners of Tmem198 remain to be discovered?

While Tmem198 is known to interact with LRP6 and casein kinase family proteins to promote Wnt signaling , additional interaction partners likely exist and remain to be discovered. Potential interaction partners might include other components of the Wnt signaling pathway, such as Frizzled receptors, Dishevelled proteins, or β-catenin regulators. Transmembrane proteins often function within larger complexes, suggesting Tmem198 may also interact with membrane-organizing proteins, cytoskeletal elements, or other signaling pathway components. To identify novel interaction partners, researchers should consider employing techniques such as proximity labeling (BioID or APEX), co-immunoprecipitation followed by mass spectrometry, or yeast two-hybrid screening. These approaches would help construct a more comprehensive protein interaction network for Tmem198 and potentially reveal new functional roles beyond its established role in Wnt signaling.

What evolutionary insights can be gained from comparative analysis of Tmem198 across species?

Comparative analysis of Tmem198 across species could provide valuable insights into its evolutionary conservation and functional importance. Research indicates that Tmem198 has been identified in both mammalian cells and Xenopus , suggesting conservation across vertebrates. Evolutionary analysis could reveal conserved domains that are likely essential for function, as well as species-specific adaptations that might reflect specialized roles. Researchers should perform phylogenetic analyses of Tmem198 sequences across diverse organisms, analyze selection pressures on different protein domains, and compare expression patterns and developmental roles across species. Such comparative approaches might reveal how Tmem198's role in Wnt signaling has evolved and potentially identify novel functions that have emerged in specific lineages, providing deeper understanding of its biological significance.