Recombinant Mouse Transmembrane protein 70, mitochondrial (Tmem70)

What is the molecular structure and function of TMEM70 in mitochondria?

TMEM70 is a mitochondrial inner membrane protein with a cleavable N-terminal mitochondrial targeting sequence and two transmembrane segments. Its structure includes:

• Precursor protein (29 kDa) and mature form (20.7 kDa)

• N-terminal domain localized in the matrix

• Two transmembrane segments spanning the inner mitochondrial membrane

• C-terminal hydrophilic domain also positioned in the matrix

• Conserved DUF1301 domain with functional significance

TMEM70 serves as a specific ancillary factor for ATP synthase assembly, particularly facilitating the incorporation of subunit c into the rotor structure. This represents a critical and rate-limiting step in ATP synthase biogenesis, essential for achieving physiologically adequate levels of complex V in mammalian tissues .

How does TMEM70 contribute to ATP synthase assembly at the molecular level?

TMEM70 facilitates ATP synthase assembly through the following mechanism:

• Direct interaction with subunit c of ATP synthase

• Promotion of subunit c incorporation into the rotor structure of the enzyme

• Without TMEM70, cells form incomplete ATP synthase complexes consisting of F₁ domain and peripheral stalk but lacking the Fₙ proton channel

Experimental evidence demonstrates that:

• TMEM70 knockout prevents incorporation of hydrophobic subunit c into the rotor structure

• Overexpression of subunit c in TMEM70-deficient cells partially rescues the defect

• TMEM70 knockdown prevents subunit c accumulation otherwise observed in Fₙ-deficient cells

This molecular function explains why TMEM70 mutations represent the most common cause of nuclear-origin ATP synthase deficiency .

What experimental models are available for studying TMEM70 function?

Several experimental models have been developed to study TMEM70:

The rat model has particular advantages for cardiovascular research due to its size and larger blood volume compared to mice, making it valuable for studying the cardiac manifestations of TMEM70 deficiency .

What is the phenotypic spectrum of TMEM70 deficiency in animal models and humans?

TMEM70 deficiency presents with varying severity across species:

Human manifestations:

• Neonatal mitochondrial encephalocardiomyopathy

• Hypertrophic cardiomyopathy

• Lactic acidosis

• 3-methylglutaconic aciduria

• Early death in severe cases

• Hypotonia

• Hyperammonemia

• Some patients present with hypercitrullinemia

Animal models:

• Homozygous knockout is embryonically lethal in both mice and rats

• Heterozygous animals show variable biochemical and functional impairments

• Transgenic rescue in rats with 16-49% TMEM70 protein restoration shows:

  • Full biochemical complementation in liver

  • Partial complementation in heart

  • Minor impairment in left ventricular function

Variability in clinical outcome is observed even within families with identical mutations, suggesting the involvement of genetic modifiers or environmental factors .

What methodologies are most effective for measuring TMEM70 expression and function?

Recommended methodologies for TMEM70 analysis:

• Protein detection and localization:

  • Western blot using specific antibodies (observed at 18 kDa)

  • Cell fractionation to confirm mitochondrial localization

  • Salt/carbonate treatment to verify integral membrane protein characteristics

  • Proteinase K accessibility assays following osmotic swelling

  • Expansion microscopy for high-resolution localization

• Functional assessment:

  • Blue Native gel electrophoresis to detect assembled ATP synthase

  • In-gel ATPase activity assays

  • Oxygen consumption measurements

  • ATP production assays

  • Mitochondrial membrane potential measurements using TMRM staining

• Genetic analysis:

  • Whole exome sequencing for mutation identification

  • Sanger sequencing for validation (primers: forward 5′- ctgtttctggcgttgggcag -3′; reverse 5′- tcccgaaggccccgtactc-3′)

  • qPCR for transgene expression analysis

How does TMEM70 expression influence mitochondrial biogenesis and mtDNA levels?

While TMEM70 primarily functions in ATP synthase assembly, there is evidence of broader effects on mitochondrial biogenesis:

• Connection to mitochondrial biogenesis:

  • TMEM70 overexpression increases mtDNA levels significantly

  • TMEM70 knockout leads to reduction of mtDNA

  • TMEM70 affects expression of DNA polymerase γ (Mip1 in yeast), which is responsible for mtDNA replication

  • The increased abundance of Mip1 in TMEM70 overexpression likely contributes to observed mtDNA increases

• Transcriptional effects:

  • TMEM70 overexpression increases mRNA levels of nucleus-encoded mitochondrial proteins

  • This transcriptional activation extends beyond Tom70's substrates

  • Selective removal of TMEM70 reduces mRNA levels of many mitochondrial proteins

  • mtDNA is required for TMEM70-mediated transcriptional activation of nuclear-encoded mitochondrial proteins

These findings suggest TMEM70 plays a wider role in coordinating mitochondrial biogenesis than previously thought.

What ultrastructural changes occur in mitochondria due to TMEM70 deficiency?

TMEM70 deficiency causes distinctive ultrastructural abnormalities in mitochondria:

• Electron microscopy findings:

  • Accumulation of swollen degenerated mitochondria

  • Presence of lipid crystalloid inclusions within mitochondria

  • Cristae aggregation

  • Exocytosis of mitochondrial material

• Methodological approach for ultrastructural analysis:

  • Initial fixation with 2.5% glutaraldehyde buffered in cacodylate

  • Secondary fixation in 1% osmium tetroxide

  • Dehydration in graded ethanol series with uranyl acetate incubation

  • Embedding in epoxy resins

  • Preparation of semithin sections (0.5 μm) for light microscopy

  • Ultrathin sections (50–70 nm) for TEM

  • Contrasting with uranyl acetate and lead citrate

  • Imaging using transmission electron microscopy at 120 kV

These ultrastructural changes provide insights into the pathological consequences of ATP synthase deficiency at the organelle level.

What therapeutic approaches have been tested for TMEM70 deficiency?

Several therapeutic strategies have been explored:

• Genetic complementation:

  • Transgenic rescue in rat models using wild-type TMEM70 under EF-1α universal promotor

  • 16-49% restoration of TMEM70 protein in liver and heart was sufficient for full biochemical complementation in liver

  • Expression of wild-type TMEM70 in patient fibroblasts restores ATP synthase content and function

• Metabolic support:

  • Supplementation with anaplerotic amino acids

  • Lipid supplementation

  • Symptomatic treatment during metabolic crises

  • Some patients with proper management survive despite harboring the same mutations that proved fatal in siblings

• Subunit c overexpression:

  • Overexpression of subunit c in TMEM70-deficient cells partially rescues the defect

  • Suggests potential for gene therapy approaches targeting downstream components

These findings indicate that even partial restoration of ATP synthase function may be sufficient for clinical improvement.

How can researchers distinguish between TOM70 and TMEM70 in experimental settings?

Despite similar names, TOM70 and TMEM70 are distinct proteins with different functions that require careful differentiation:

Experimental differentiation approaches:

• Use specific antibodies validated for each protein

• Subcellular fractionation can separate inner from outer membrane proteins

• Functional assays: TMEM70 affects ATP synthase assembly while TOM70 affects protein import

• TOM70 interacts with Hsp90 via its clamp domain (R192), a feature not shared by TMEM70

TOM70 has been additionally implicated in mitochondrial biogenesis regulation and antiviral signaling pathways, functions distinct from TMEM70's role in ATP synthase assembly .

What are the most common mutations in TMEM70 and their functional consequences?

TMEM70 mutations represent the most frequent cause of nuclear-encoded ATP synthase deficiency:

Functional consequences include:

• Reduced content of assembled ATP synthase (to 20-30% of normal)

• Most severely affected subunit is subunit c (9-10 fold reduction vs 2-3 fold for other subunits)

• Formation of incomplete ATP synthase complex

• Impaired mitochondrial ATP production

• Disrupted mitochondrial membrane potential

The TMEM70 gene appears particularly prone to mutagenesis, with over 20 different mutations reported in more than 50 affected families .

What is the optimal protocol for using recombinant mouse TMEM70 in research applications?

For researchers working with recombinant mouse TMEM70:

Recommended handling protocol:

• Storage considerations:

  • Store at -20°C; for extended storage, conserve at -80°C

  • Avoid repeated freezing and thawing

  • Working aliquots can be stored at 4°C for up to one week

  • Protein is typically supplied in Tris-based buffer with 50% glycerol

• Application-specific recommendations:

  • For Western blotting: Use 1:1000-1:4000 dilution

  • For immunohistochemistry: Use 1:50-1:500 dilution

  • For ELISA: Optimize concentration based on specific assay design

• Experimental considerations:

  • When studying protein-protein interactions, consider using tagged versions

  • For functional studies, complement with native protein analyses

  • Account for the presence of tag sequences when interpreting molecular weight

  • Mouse TMEM70 (Q921N7) spans amino acids 78-253 in the recombinant form

How can researchers develop effective knockout or knockdown models for TMEM70?

Based on successful approaches in the literature:

For genomic knockout:

• CRISPR/Cas9 targeting exon 1 or 2 of TMEM70

• ZFN (Zinc Finger Nuclease) approach targeting exon 1 has been successful in rat models

  • Specific approach: ZFN construct designed to target first exon resulting in 131 bp deletion (nt 236-366)

For knockdown approaches:

• Doxycycline-inducible shRNA system in stably transduced cell lines

  • Allows for controlled timing of TMEM70 depletion

  • Effective knockdown achieved after 6 days of shRNA expression

For transgenic rescue:

• Sleeping Beauty transposon system with wild-type TMEM70 cDNA

• Use of universal promoters like EF-1α to drive expression

• PCR validation using primers specific for vector TMEM70 cDNA (no introns):

  • Forward (exon 1): GGCAGGCTGATTTATACTGGGA

  • Reverse (exon 2): AAGGCTGACCACACTTGTAGA

Important considerations:

• Homozygous knockouts are embryonically lethal at ~E9

• Consider tissue-specific conditional knockout approaches for postnatal studies

• Heterozygous models may show subtle phenotypes useful for certain studies