Recombinant Mouse Tumor necrosis factor receptor superfamily member 9 (Tnfrsf9)

What is TNFRSF9 and what are its primary functions in the immune system?

TNFRSF9 (Tumor Necrosis Factor Receptor Superfamily Member 9), also known as 4-1BB and CD137, is a costimulatory receptor primarily expressed on activated immune cells. It functions as a critical regulator of immune responses through several mechanisms:

TNFRSF9 signaling is initiated upon receptor binding, which recruits TNFR-associated factors 1 and 2, leading to activation of the transcription factor NF-κB and the mitogen-activated protein kinase (MAPK) cascade . In CD8+ T cells, TNFRSF9 signaling promotes activation, proliferation, and production of cytokines including interleukin 2 (IL-2) and interferon gamma (IFN-γ) . Additionally, TNFRSF9 signaling contributes to upregulation of anti-apoptotic Bcl-2 family members, protecting T cells against activation-induced cell death .

The receptor's role extends beyond T cells, as it is also expressed by inflamed or hypoxic endothelial cells and has been detected on tumor endothelial cells . In the tumor microenvironment, hypoxia-mediated TNFRSF9 signaling has been shown to promote migration of tumor-infiltrating lymphocytes (TILs) into malignant tissue .

How is TNFRSF9 gene expression regulated at the epigenetic level?

TNFRSF9 gene expression is significantly regulated through DNA methylation mechanisms. Research has identified multiple CpG sites within the TNFRSF9 gene where methylation status correlates with expression levels.

A comprehensive analysis of twelve CpG sites within TNFRSF9 revealed a significant inverse correlation between DNA methylation and mRNA expression levels at six of these sites (P ≤ 0.005), predominantly located in the promoter flank region . This suggests that hypermethylation at these specific sites suppresses TNFRSF9 expression, while hypomethylation facilitates increased expression.

The regulatory relationship between methylation and expression has been validated in multiple patient cohorts, including The Cancer Genome Atlas dataset (N = 470 melanoma patients) and an independent validation cohort (N = 115 melanoma patients) . These findings provide strong evidence that epigenetic mechanisms play a crucial role in controlling TNFRSF9 expression levels.

What methods are recommended for analyzing TNFRSF9 mRNA expression in experimental samples?

For accurate analysis of TNFRSF9 mRNA expression, quantitative reverse transcription PCR (qRT-PCR) is the recommended approach. The following methodological details should be considered:

Primer design is critical for specificity. Based on published protocols, researchers can use primers such as 5'-TTGGGAACATTTAATGACCAGA-3' and 5'-TCCCGGTCTTAAGCACAGAC-3', designed based on GenBank accession number NM_011612, with an optimal annealing temperature of 62°C . This produces a 91 base pair amplicon that is common for both splice variants of TNFRSF9 mRNA .

For normalization, 18S rRNA is an appropriate housekeeping target. Using primers 5'-CGGCTACCACATCCAAGGAA-3' and 5'-GCTGGAATTACCGCGGCT-3' (based on GenBank accession number NR_003278) with an annealing temperature of 61.8°C generates a 187 base pair amplicon .

The expression data should be reported as relative TNFRSF9 mRNA levels normalized to the housekeeping gene. This approach allows for reliable quantification of TNFRSF9 expression across different experimental conditions or clinical samples.

What are the key considerations when working with recombinant mouse TNFRSF9 protein in experimental systems?

When utilizing recombinant mouse TNFRSF9 protein in experimental systems, several technical considerations are essential:

For protein reconstitution, recombinant mouse TNFRSF9 is typically provided as a lyophilized product and should be reconstituted at a concentration of approximately 100 μg/mL in sterile PBS, either with or without a carrier protein such as bovine serum albumin (BSA) . The choice between carrier-free or BSA-containing formulations depends on the specific application; BSA-containing formulations enhance protein stability and increase shelf-life, making them suitable for cell culture applications, while carrier-free versions are preferred for applications where BSA might interfere .

Storage conditions significantly impact protein stability. Researchers should use a manual defrost freezer and avoid repeated freeze-thaw cycles to maintain protein integrity . Prior to experimental use, it's important to verify protein activity and structural integrity, as recombinant mouse TNFRSF9 protein typically forms a homotrimer with a molecular weight of approximately 50.8 kDa when analyzed by SEC-MALS .

How does TNFRSF9 methylation status correlate with immune cell infiltration and clinical outcomes in cancer patients?

TNFRSF9 methylation status shows significant correlations with immune infiltration patterns and clinical outcomes, particularly in melanoma patients:

The relationship between methylation and clinical outcomes extends to treatment response. In patients receiving anti-PD-1 immunotherapy, TNFRSF9 hypermethylation and consequent reduced mRNA expression correlated with poor progression-free survival (PFS) and diminished therapeutic response . This pattern was observed in multiple independent cohorts, including an mRNA cohort (N = 121 patients) and a DNA methylation cohort (N = 48 patients) , suggesting that TNFRSF9 methylation status might serve as a predictive biomarker for immunotherapy efficacy.

What methodological approaches are most effective for studying TNFRSF9 methylation as a potential biomarker in cancer immunotherapy?

For investigating TNFRSF9 methylation as a potential biomarker, several methodological approaches have demonstrated effectiveness:

Quantitative methylation-specific PCR (qMSP) provides a reliable technique for analyzing promoter methylation levels at specific CpG sites. In validated protocols, researchers have successfully targeted CpG sites in the TNFRSF9 promoter region, such as those located at chromosome 1: 7,941,202–7,941,277 (according to GRCh38.p13) . For specific CpG analysis, custom-designed assays can be developed using appropriate primers and dual-labeled probes that distinguish between methylated and unmethylated sequences.

For example, a validated qMSP assay for the TNFRSF9 promoter region uses:

• Forward primer: actccataatcactataatacaataa

• Reverse primer: gtagtgtatttttgatgtttggta

• Probe (methylated): 6-FAM-ccattacttaaacacaaccgata-BHQ-1

• Probe (unmethylated): HEX-accattacttaaacacaaccaatat-BHQ-1

Correlation analyses should combine methylation data with transcriptional activity, immune cell infiltration parameters, mutation status, and survival outcomes to develop comprehensive predictive models. Case-control study designs comparing responders and non-responders to immunotherapy have been particularly informative for establishing TNFRSF9 methylation as a potential predictive biomarker .

How do TNFRSF9-targeted immunotherapies compare with other checkpoint-targeting approaches in preclinical models?

TNFRSF9-targeted approaches offer distinctive mechanisms compared to other checkpoint-targeting immunotherapies:

While PD-1/PD-L1 pathway inhibitors work by blocking inhibitory signals, TNFRSF9-targeting agents (typically agonistic antibodies) function by enhancing costimulatory signals in T cells. This fundamental difference in mechanism means that TNFRSF9 agonists might complement rather than duplicate the effects of established checkpoint inhibitors.

In preclinical models, agonistic TNFRSF9 antibodies have demonstrated efficacy by restoring CD8+ T cell function, particularly in melanoma models such as B16.SIY . The therapeutic effects appear to involve enhanced T cell activation, proliferation, and cytokine production, along with protection against activation-induced cell death .

The differing mechanisms also suggest potential combination strategies. Current clinical trials are exploring agonistic TNFRSF9 antibodies both as monotherapy and in combination with established checkpoint inhibitors, based on the hypothesis that simultaneous blockade of inhibitory signals and enhancement of costimulatory signals could produce synergistic anti-tumor effects .

What experimental design considerations are critical when evaluating the relationship between TNFRSF9 methylation and response to immunotherapy?

When designing experiments to evaluate the relationship between TNFRSF9 methylation and immunotherapy response, several critical considerations should be addressed:

Sample selection and cohort design significantly impact the validity of findings. Case-control studies comparing responders versus non-responders to immunotherapy (e.g., anti-PD-1 treatment) have proven effective, as demonstrated in previously validated cohorts . Researchers should ensure adequate sample sizes with balanced clinical characteristics to minimize confounding factors.

Multiple CpG site analysis is essential, as the correlation between methylation and expression varies across different sites within the TNFRSF9 gene. Previous research identified six CpG sites showing significant inverse correlation with expression, predominantly in the promoter flank region . Therefore, comprehensive analysis should target multiple relevant CpG sites rather than a single location.

How does TNFRSF9 function differ between mouse models and human clinical samples, and what are the implications for translational research?

Understanding species-specific differences in TNFRSF9 function is critical for translational research:

While mouse TNFRSF9 shares significant sequence homology with human TNFRSF9, there are differences in expression patterns and potentially in signaling dynamics that must be considered when extrapolating from mouse models to human applications. Within the extracellular domain, mouse TNF-alpha (a related TNF superfamily member) shares 70%-77% amino acid sequence identity with human TNF-alpha , suggesting that similar degrees of conservation may exist for TNFRSF9.

These differences can impact experimental design choices, particularly regarding the selection of appropriate recombinant proteins and targeting antibodies. When using recombinant mouse TNFRSF9 in experimental systems, researchers must validate that the protein accurately represents the physiological form, including proper post-translational modifications and functional activity.

For translational studies, researchers should consider using humanized mouse models or patient-derived xenografts to better recapitulate human TNFRSF9 biology in preclinical studies. Additionally, parallel analyses of mouse and human samples can help identify both conserved and divergent aspects of TNFRSF9 function, enabling more accurate predictions of clinical outcomes based on preclinical data.