Recombinant Oncorhynchus nerka NADH-ubiquinone oxidoreductase chain 4L (MT-ND4L)

What is MT-ND4L and what is its primary function in cellular metabolism?

MT-ND4L (NADH-ubiquinone oxidoreductase chain 4L) is a protein encoded by the mitochondrial genome that functions as a core subunit of Complex I in the mitochondrial respiratory chain. This protein participates in the first step of the electron transport process, transferring electrons from NADH to ubiquinone during oxidative phosphorylation. MT-ND4L is embedded in the inner mitochondrial membrane and plays a crucial role in creating the electrochemical gradient necessary for ATP production . In Oncorhynchus nerka, the protein consists of 98 amino acids and is characterized by multiple transmembrane domains that facilitate its integration into the membrane arm of Complex I .

How does the amino acid sequence of Oncorhynchus nerka MT-ND4L compare to homologs in other species?

The amino acid sequence of Oncorhynchus nerka MT-ND4L (MTPVHFSFTSA FILGLMGLAF HRTHLLSALL CLEGMMLSLF IALSLWALQM EATGYSVAPML LLAFSACEAS AGLALLVATA RTHGTDRLQS LNLLQC) shows significant conservation in functional domains when compared to other vertebrate species . This conservation reflects the protein's essential role in mitochondrial respiration.

Comparison of key functional domains across species:

This high degree of conservation, particularly in the transmembrane domains, indicates the functional constraints on this protein throughout evolution. Methodological approaches to studying these evolutionary patterns include multiple sequence alignment, phylogenetic analyses, and protein structure prediction algorithms.

What are the optimal conditions for expressing and purifying recombinant MT-ND4L from Oncorhynchus nerka?

When expressing and purifying recombinant Oncorhynchus nerka MT-ND4L, researchers should implement the following methodological approach:

• Expression System Selection: Bacterial systems (E. coli) are suitable for initial studies, but eukaryotic systems (insect cells, yeast) often yield better results for membrane proteins like MT-ND4L.

• Solubilization Strategy: Given MT-ND4L's hydrophobic nature, optimize solubilization using:

  • Mild detergents (DDM, LDAO) at concentrations just above their critical micelle concentration

  • Buffer system containing 50mM Tris-HCl (pH 7.5), 150-300mM NaCl

  • Addition of glycerol (20-50%) to enhance stability

• Purification Protocol: Implement a multi-step approach:

  • Initial IMAC (immobilized metal affinity chromatography) if using histidine-tagged constructs

  • Size exclusion chromatography to remove aggregates

  • Ion exchange chromatography for final polishing

  • Maintain detergent above CMC throughout all purification steps

• Quality Control: Verify protein integrity through Western blotting, mass spectrometry, and functional assays measuring electron transfer activity.

The purified protein can be stored in Tris-based buffer with 50% glycerol at -20°C for short-term and -80°C for long-term storage, though repeated freeze-thaw cycles should be avoided .

What analytical techniques are most effective for studying MT-ND4L interactions within Complex I?

To elucidate MT-ND4L interactions within Complex I, researchers should consider a multi-faceted analytical approach:

• Crosslinking Mass Spectrometry (XL-MS): This technique identifies spatial relationships between MT-ND4L and adjacent subunits through covalent crosslinks followed by proteolytic digestion and mass spectrometry analysis.

• Cryo-Electron Microscopy: High-resolution structural analysis provides direct visualization of MT-ND4L's position within the Complex I architecture.

• Computational Approaches:

  • Molecular dynamics simulations exploring conformational changes

  • AI-driven conformational ensemble generation to predict functional states

  • Structure-aware pocket detection algorithms to identify potential binding sites

• Functional Assays:

  • Measuring electron transfer rates using spectrophotometric techniques

  • Membrane potential assays using fluorescent probes

  • Site-directed mutagenesis to validate key interaction residues

These methodologies can be integrated to develop a comprehensive model of how MT-ND4L contributes to Complex I assembly, stability, and function in oxidative phosphorylation.

How is MT-ND4L used as a genetic marker in evolutionary studies of salmonid species?

MT-ND4L serves as a valuable genetic marker in evolutionary studies of salmonids due to its mitochondrial origin and evolutionary characteristics. Researchers utilize the following methodological approach when employing MT-ND4L in evolutionary analyses:

• Sample Collection and DNA Extraction: Tissue samples (typically fin clips or muscle) from diverse salmonid populations are collected and processed using standard DNA extraction protocols optimized for mitochondrial DNA recovery.

• Amplification Strategy: PCR amplification using specialized primers (such as ARG-BL and ND4LRBS - 5'TGTTGGAAATAGCATAATCG3') allows characterization of the entire gene .

• Analytical Techniques:

  • Single-stranded conformational polymorphisms (SSCPs) to identify sequence variants

  • Next-generation sequencing for comprehensive haplotype identification

  • Comparative sequence analysis to identify fixed differences between species

• Data Interpretation:

  • Researchers analyze patterns of introgression and hybridization, as demonstrated in studies of Klamath Basin species where mismatched mtDNA has been observed

  • Haplotype networks are constructed to visualize evolutionary relationships

  • Statistical tests for selection are performed to identify potential adaptive changes

For example, in studies of Klamath Basin species, researchers used MT-ND4L alongside ND2 to assess genetic variation patterns and found evidence of asymmetrical introgression, with Deltistes luxatus being the primary source of mismatched mtDNA in other species .

What methodological challenges arise when using MT-ND4L sequences for phylogenetic reconstruction?

Researchers face several methodological challenges when using MT-ND4L sequences for phylogenetic reconstruction:

• Heteroplasmy Detection: The presence of multiple mitochondrial haplotypes within individuals can confound analyses. Methodological solutions include:

  • Deep sequencing approaches to quantify heteroplasmic variants

  • Statistical methods to distinguish true heteroplasmy from sequencing errors

  • Cloning of PCR products followed by individual sequencing

• Introgression and Hybridization: As seen in the Klamath Basin species, MT-ND4L can exhibit patterns of introgression that complicate phylogenetic analyses . Researchers should:

  • Employ multiple nuclear markers alongside MT-ND4L

  • Implement statistical methods to detect and account for introgression events

  • Consider species tree methods rather than gene tree approaches

• Substitution Rate Heterogeneity: MT-ND4L can exhibit variable evolutionary rates across lineages. Methods to address this include:

  • Using relaxed molecular clock models in phylogenetic analyses

  • Implementing mixture models of amino acid evolution

  • Partitioning analyses to account for variable rates across sites

• Taxonomic Sampling: Incomplete sampling can lead to misleading phylogenetic inferences. Researchers should:

  • Include representatives from all relevant taxonomic groups

  • Consider the potential impact of missing taxa through simulation studies

  • Be cautious in interpretation when sampling is limited

What is the evidence linking MT-ND4L variants to neurodegenerative diseases?

Recent research has revealed significant associations between MT-ND4L variants and neurodegenerative conditions:

• Alzheimer's Disease Association: A whole exome sequencing study involving 10,831 participants from the Alzheimer's Disease Sequencing Project (ADSP) identified a rare MT-ND4L variant (rs28709356 C>T; minor allele frequency = 0.002) with study-wide significant association with Alzheimer's disease (P = 7.3 × 10⁻⁵) . Additionally, gene-based testing revealed significant association of MT-ND4L with AD (P = 6.71 × 10⁻⁵) .

• Leber Hereditary Optic Neuropathy: A specific mutation in MT-ND4L (T10663C or Val65Ala) has been identified in several families with Leber hereditary optic neuropathy. This mutation changes the valine amino acid at position 65 to alanine, potentially affecting protein function .

• Methodological Approaches for Clinical Studies:

  • Accurate assembly and variant calling in mitochondrial genomes from whole exome sequences

  • Statistical analysis using SCORE test for variant association and SKAT-O for gene-based tests

  • Integration with nuclear gene data, particularly genes involved in mitochondrial function (such as TAMM41)

These findings suggest that MT-ND4L plays a potentially important role in neurodegenerative processes, possibly through mechanisms involving mitochondrial dysfunction and energy metabolism disruption. Researchers investigating this relationship should consider both mitochondrial and nuclear genetic factors, as demonstrated by the complementary findings with TAMM41, a nuclear gene related to mitochondrial function that also showed significant association with AD .

What experimental models are most appropriate for studying MT-ND4L mutations and their phenotypic effects?

When investigating MT-ND4L mutations and their phenotypic consequences, researchers should consider the following experimental models and methodological approaches:

• Cellular Models:

  • Cybrid cell lines (cells depleted of endogenous mtDNA and repopulated with patient-derived mtDNA) allow isolation of mitochondrial effects

  • CRISPR-based mitochondrial DNA editing, though technically challenging, permits precise mutation introduction

  • Patient-derived fibroblasts or induced pluripotent stem cells (iPSCs) provide physiologically relevant contexts

• Animal Models:

  • Transgenic mouse models expressing mutant MT-ND4L

  • Zebrafish models for high-throughput phenotypic screening

  • Drosophila models for rapid generation time and powerful genetic tools

• Functional Assessment Protocols:

  • Respirometry to measure oxygen consumption and electron transport chain activity

  • Reactive oxygen species (ROS) quantification using fluorescent probes

  • ATP production assays to evaluate energetic consequences

  • Mitochondrial membrane potential measurements

• Multi-omics Integration:

  • Proteomics to assess effects on Complex I assembly and stability

  • Metabolomics to identify disrupted metabolic pathways

  • Transcriptomics to evaluate retrograde signaling effects on nuclear gene expression

These models allow researchers to establish causality between specific MT-ND4L mutations and phenotypic outcomes, such as the association with Alzheimer's disease or Leber hereditary optic neuropathy .

How do conformational changes in MT-ND4L affect Complex I function, and what methods can detect these dynamic processes?

MT-ND4L undergoes conformational changes that are critical for Complex I function. Advanced research methodology to investigate these dynamics includes:

• Hydrogen-Deuterium Exchange Mass Spectrometry (HDX-MS):

  • This technique measures the exchange rate of amide hydrogens with deuterium in the solvent

  • Slower exchange rates indicate protected regions, often involved in protein-protein interactions

  • Comparison of exchange rates under different conditions reveals conformational changes

  • Sample preparation must be optimized for membrane proteins like MT-ND4L

• AI-Enhanced Molecular Dynamics Simulations:

  • Advanced AI algorithms predict alternative functional states, including large-scale conformational changes along "soft" collective coordinates

  • Enhanced sampling techniques overcome energy barriers that limit conventional simulations

  • Trajectory clustering identifies representative structures from the conformational ensemble

  • Diffusion-based AI models and active learning AutoML generate statistically robust ensembles of equilibrium conformations

• Single-Molecule FRET:

  • Strategic placement of fluorophore pairs allows real-time monitoring of distance changes

  • Detergent-solubilized or nanodisc-reconstituted protein preparations maintain native-like environments

  • Time-resolved measurements capture transient conformational states

• Cryo-EM Classification Analysis:

  • 3D classification of particle images can resolve different conformational states

  • Time-resolved cryo-EM captures intermediates during the catalytic cycle

  • Local resolution analysis identifies flexible regions that may undergo conformational changes

The integration of these methodologies provides a comprehensive view of MT-ND4L dynamics within Complex I and how these movements coordinate electron transfer and proton pumping during oxidative phosphorylation.

What approaches can resolve contradictory data regarding MT-ND4L contributions to proton translocation in Complex I?

Resolving contradictory data regarding MT-ND4L's role in proton translocation requires sophisticated methodological approaches:

• Site-Directed Mutagenesis Coupled with Functional Assays:

  • Systematic mutation of conserved residues potentially involved in proton pathways

  • Quantitative analysis of proton pumping efficiency using pH-sensitive probes

  • Correlation of specific mutations with altered proton/electron stoichiometry

  • Construction of the following mutation series to test specific hypotheses:

• Multi-Scale Computational Modeling:

  • Quantum mechanics/molecular mechanics (QM/MM) simulations of proton transfer events

  • Continuum electrostatics calculations to identify energetically favorable proton pathways

  • Graph-theoretical analyses to identify potential proton-conducting networks

• Integrative Structural Biology:

  • Cross-linking mass spectrometry to identify residue proximities in different functional states

  • Electron paramagnetic resonance (EPR) spectroscopy to measure distances between specifically labeled sites

  • Neutron diffraction to directly visualize proton positions, when feasible

• Reconstitution Experiments:

  • Selective incorporation of purified Complex I with wild-type or mutant MT-ND4L into liposomes

  • Direct measurement of proton translocation using pH-sensitive fluorescent dyes

  • Comparison with other Complex I subunits known to be involved in proton translocation

By implementing these complementary approaches, researchers can systematically evaluate conflicting data regarding MT-ND4L's contribution to the proton translocation mechanism of Complex I.

What novel therapeutic approaches targeting MT-ND4L are emerging for mitochondrial disorders?

Emerging therapeutic approaches targeting MT-ND4L represent a frontier in mitochondrial medicine research. The following methodological strategies are being developed:

• Small Molecule Modulators:

  • AI-based pocket prediction has identified orthosteric, allosteric, hidden, and cryptic binding pockets on MT-ND4L's surface

  • Structure-aware ensemble-based detection algorithms utilizing protein dynamics have revealed potential targetable sites

  • Rational drug design approaches focus on:

    • Stabilizing mutant MT-ND4L protein conformation

    • Enhancing electron transfer efficiency in partially functional complexes

    • Reducing harmful reactive oxygen species production from dysfunctional Complex I

• Gene Therapy Approaches:

  • Mitochondrially-targeted RNA import systems to deliver therapeutic RNAs

  • Allotopic expression of recoded MT-ND4L from the nuclear genome with mitochondrial targeting sequences

  • CRISPR/Cas9-based approaches for mitochondrial DNA editing, though technically challenging

• Alternate Electron Transfer Pathways:

  • Short-circuit electron transfer using alternative ubiquinone analogs

  • Bypass strategies that redirect electron flow around Complex I defects

  • Engineered alternative NADH oxidation systems

• Protein Replacement Strategies:

  • Fusion of MT-ND4L to cell-penetrating peptides for direct protein delivery

  • Nanoparticle-based delivery systems targeting mitochondria

  • Liposome-mediated protein transfer to mitochondria

These therapeutic approaches are particularly relevant for conditions associated with MT-ND4L mutations, such as Leber hereditary optic neuropathy and potentially Alzheimer's disease .

How might systems biology approaches integrate MT-ND4L function within broader mitochondrial and cellular networks?

Systems biology approaches offer powerful frameworks for understanding MT-ND4L function within the context of integrated cellular networks:

• Multi-omics Data Integration Methodologies:

  • Integration of proteomics, transcriptomics, and metabolomics data using:

    • Bayesian network analysis to identify causal relationships

    • Machine learning approaches to classify patterns associated with MT-ND4L dysfunction

    • Constraint-based modeling to predict metabolic consequences of MT-ND4L variants

  • Techniques must account for both mitochondrial and nuclear genetic contributions

• Flux Balance Analysis and Extensions:

  • Construction of genome-scale metabolic models incorporating MT-ND4L function

  • Dynamic flux balance analysis to capture temporal aspects of MT-ND4L-related metabolic changes

  • Integration with regulatory models to account for retrograde signaling from mitochondria to nucleus

• Network Analysis Approaches:

  • Protein-protein interaction networks centered on MT-ND4L and Complex I

  • Metabolic control analysis to quantify MT-ND4L control coefficients for various mitochondrial functions

  • Identification of network motifs and modules affected by MT-ND4L dysfunction

• Computational Modeling of Mitochondrial Dynamics:

  • Agent-based models of mitochondrial fission/fusion dynamics influenced by MT-ND4L function

  • Spatial models incorporating mitochondrial movement and localization

  • Multi-scale models linking molecular events at MT-ND4L to cellular and tissue-level phenotypes

These systems approaches can help resolve seemingly contradictory findings regarding MT-ND4L by placing them within broader biological contexts and considering emergent properties that arise from complex interactions across multiple biological scales.