Recombinant Pan troglodytes NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 3 (NDUFA3)

What is the structural and functional role of NDUFA3 in mitochondrial complex I?

NDUFA3 is a supernumerary subunit of mitochondrial complex I (NADH:ubiquinone oxidoreductase) that plays a crucial role in the assembly and stability of the matrix arm of the complex. During the formation of mitochondrial complex I, the core subunit ND1 interacts with the Q module to form a 273 kDa complex, after which NDUFA3, along with NDUFA8 and NDUFA13, is recruited to create an intermediate product of approximately 283 kDa called Q/Pp-a . This supernumerary subunit is essential for mitochondrial subunit assembly, maintaining stable groups, and facilitating electron transport through the respiratory chain . Studies using knockdown techniques have demonstrated that NDUFA3 is necessary for the formation of a functional complex I holoenzyme .

What is the expression pattern of NDUFA3 in different tissues of Pan troglodytes?

The NDUFA3 gene demonstrates significant expression across pivotal developmental stages, including embryonic, fetal, infant, and adult phases . In terms of tissue-specific expression, NDUFA3 shows predominant presence in bone marrow, muscles, pituitary gland, prostate, salivary glands, skin, and blood . Additionally, notable expression is observed in brain tissue, highlighting its importance in neural tissues . While these expression patterns have been primarily documented in human studies, the high conservation of NDUFA3 suggests that similar expression profiles may exist in Pan troglodytes, though specific chimpanzee expression studies would be needed to confirm this definitively.

How do mutations in NDUFA3 affect mitochondrial complex I assembly and function in primate models?

Mutations in NDUFA3 significantly disrupt the assembly and function of mitochondrial complex I. Research has identified compound heterozygous mutations in the NDUFA3 gene (at positions c.10+1G>T and c.66_68delCTT) associated with Leigh syndrome, a severe mitochondrial disorder . These mutations impair the crucial role of NDUFA3 in forming the Q/Pp-a intermediate during complex I assembly, which subsequently affects electron transfer from NADH to the respiratory chain . In cellular models, knockdown of NDUFA3 expression using miRNAs has demonstrated that this subunit is necessary for the formation of a functional holoenzyme and is specifically required for assembly and/or stability of the electron-transferring Q module in the peripheral arm of complex I . While human models have been more extensively studied, the high conservation of the protein suggests similar consequences would occur in Pan troglodytes, though primate-specific research remains limited.

What evolutionary differences exist in NDUFA3 function between humans and chimpanzees that might contribute to species-specific neural development?

Comparative analyses between humans and non-human primates have revealed differential migration patterns in neural progenitor cells . While direct evidence linking NDUFA3 to these differences is not explicitly established in the literature, the protein's role in mitochondrial function suggests potential involvement in neural development variations. NDUFA3 is expressed in brain tissue , and mitochondrial function is crucial for proper neural development and migration. The heterochronic changes observed in human neurons compared to chimpanzees and bonobos may involve differences in energy metabolism pathways where NDUFA3 functions. Given that NDUFA3 is part of complex I, which provides approximately 40% of the proton-motive force used for ATP production , subtle species-specific variations in its function could contribute to the documented differences in neural development between humans and chimpanzees.

What are the optimal methods for expressing and purifying recombinant Pan troglodytes NDUFA3 for structural studies?

For expressing and purifying recombinant Pan troglodytes NDUFA3, researchers should consider a multi-step methodology based on established protocols for mitochondrial proteins. Begin with gene cloning using primers designed specifically for the Pan troglodytes NDUFA3 sequence, similar to the approach used in human NDUFA3 studies: forward primer 5'AAGCTTGGTACCGAGCTCGGATCCGCTGTCGCCGCCGCGGAGACAAAGATGG3' and reverse primer 5'TTAAACGGGCCCTCTAGACTCGAGCGAGGCCCCCGACGACGAAGGACACGAC3' . These primers can be modified based on chimpanzee-specific sequences.

The amplified product should be cloned into an appropriate expression vector, such as pMini-CopGFP at BamHI/XhoI restriction sites using a cloning kit like ClonExpress II One Step Cloning Kit . For expression, a bacterial system using E. coli BL21(DE3) is typically effective, with induction using IPTG at concentrations of 0.5-1.0 mM when cultures reach OD600 of 0.6-0.8.

Purification can be achieved through affinity chromatography using a histidine tag, followed by size exclusion chromatography to ensure high purity for structural studies. Given the small size of NDUFA3 (84 amino acids) , special care should be taken during purification to prevent protein loss. Validation of the purified protein should be performed using SDS-PAGE, Western blotting, and mass spectrometry to confirm identity and purity.

What cell-based assays are most effective for studying NDUFA3 function in mitochondrial complex I assembly?

Several cell-based assays have proven effective for studying NDUFA3 function in mitochondrial complex I assembly. RNA interference techniques using miRNAs targeting NDUFA3 can be employed to knock down its expression and observe the subsequent effects on complex I assembly and function . Analysis of assembly intermediates in mitochondria depleted for NDUFA3 can reveal its specific role in the assembly process .

Functional assays should include measurements of:

• Cell viability using assays such as MTT or resazurin reduction

• Mitochondrial membrane potential (MMP) using fluorescent probes

• Reactive oxygen species (ROS) production

• Oxygen consumption rate (OCR)

• Complex I enzymatic activity

These parameters have been successfully used to assess mitochondrial function in cells with altered NDUFA3 expression . For instance, high glucose exposure decreased cell viability, increased apoptotic cells, increased ROS production, and decreased MMP levels and OCR values in human nucleus pulposus cells in a dose-dependent manner, effects that were counteracted by NDUFA3 overexpression .

Additionally, blue native polyacrylamide gel electrophoresis (BN-PAGE) followed by immunoblotting can be used to visualize complex I assembly intermediates and assess the impact of NDUFA3 depletion or mutation on the assembly process.

How can researchers effectively create and validate NDUFA3 knockout or knockdown models in primate cell lines?

To create effective NDUFA3 knockout or knockdown models in primate cell lines, researchers should consider the following methodological approach:

For knockdown models:

• Design specific miRNAs or siRNAs targeting Pan troglodytes NDUFA3 mRNA, similar to approaches used in human cell lines .

• Transfect primary chimpanzee cell lines or immortalized cell lines with these RNA interference molecules.

• Establish stable knockdown cell lines using appropriate selection markers.

For knockout models:

• Utilize CRISPR-Cas9 gene editing with guide RNAs specifically designed for the Pan troglodytes NDUFA3 sequence.

• Screen and isolate clonal populations with confirmed knockout.

Validation of these models should include:

• qRT-PCR and Western blot analysis to confirm reduced NDUFA3 expression at mRNA and protein levels.

• Analysis of mitochondrial complex I assembly using blue native PAGE.

• Functional assays including measurements of complex I activity, oxygen consumption rate, and ROS production.

• Cell viability and apoptosis assessments using flow cytometry and appropriate staining methods .

Additionally, rescue experiments by reintroducing wild-type NDUFA3 can confirm that observed phenotypes are specifically due to NDUFA3 depletion. For mutational studies, site-directed mutagenesis can be performed using primers designed to introduce specific mutations, such as those identified in Leigh syndrome patients (c.10+1G>T and c.66_68delCTT) .

What role might NDUFA3 play in the differential neural development observed between humans and chimpanzees?

NDUFA3 may contribute to the differential neural development observed between humans and chimpanzees through its essential role in mitochondrial function. Studies have demonstrated differential migration patterns in human neural progenitor cells compared to those of chimpanzees and bonobos both in vitro and in vivo, suggesting heterochronic changes in human neurons . Given that NDUFA3 is expressed in brain tissue and is crucial for mitochondrial complex I assembly and function , variations in its expression or function could influence neural development through several mechanisms:

• Energy provision: As part of complex I, which provides approximately 40% of the proton-motive force used for ATP production , NDUFA3 is involved in cellular energy metabolism crucial for neural migration and development.

• Oxidative stress regulation: NDUFA3 has been implicated in regulating oxidative stress , which is a significant factor in neural development and differentiation.

• Mitochondrial dynamics: Proper mitochondrial function, which depends on assembled complex I, influences mitochondrial distribution in developing neurons, affecting migration and differentiation patterns.

While direct evidence linking NDUFA3 to these specific developmental differences requires further investigation, its fundamental role in mitochondrial function suggests it could be a contributing factor to the evolutionary changes in neural development that distinguish humans from our closest primate relatives.

How does the response to mitochondrial stress differ in cells expressing human versus Pan troglodytes NDUFA3?

• NDUFA3 plays a protective role against oxidative stress and apoptosis, as demonstrated in human nucleus pulposus cells, where NDUFA3 overexpression counteracted high glucose-induced injuries through suppressing cell apoptosis, eliminating ROS, and improving mitochondrial function .

• The expression of NDUFA3 increases following vigorous physical activity, potentially as a response to increased energy demands and associated oxidative stress .

• NDUFA3 is involved in regulating oxidative stress in models of brain injury , suggesting its importance in neural tissue response to stress conditions.

Given the observed differences in neural progenitor cell development and migration between humans and chimpanzees , it is plausible that subtle variations in NDUFA3 function might contribute to species-specific responses to mitochondrial stress. These differences could potentially influence cellular resilience to stress conditions, particularly in neural tissues, though direct experimental evidence comparing human and Pan troglodytes NDUFA3 under stress conditions would be required to establish such differential responses conclusively.