Recombinant Pongo abelii High affinity copper uptake protein 1 (SLC31A1)

What are the tissue expression patterns of SLC31A1?

SLC31A1 is ubiquitously expressed across all examined organs and tissues, with particularly high expression levels observed in the liver and kidney . Its subcellular localization varies depending on the cell type. In human embryonic kidney cells (HEK293), the majority of SLC31A1 is localized at the plasma membrane, similar to its yeast counterpart (yCTR1) . These distribution patterns may be associated with cell-type specific dynamics of CTR1 secretion or recycling between the plasma membrane and intracellular compartments . The widespread expression pattern reflects the universal requirement for copper as an essential cofactor in cellular metabolism.

What experimental methods are commonly used to assess SLC31A1 expression?

Several robust methods have been established to evaluate SLC31A1 expression at both mRNA and protein levels:

• Quantitative Real-Time PCR (qRT-PCR): Using specific primers for SLC31A1 (Forward: CCAGGACCAAATGGAACCATCC, Reverse: ACCACCTGGATGATGTGCAGCA), with GAPDH typically employed as an internal reference gene . The 2−ΔΔct method is commonly used to quantify relative expression levels.

• Western Blot Analysis: Using anti-SLC31A1 antibodies (such as Abcam ab129067 at 1:1000 dilution) with GAPDH (Abcam ab8245 at 1:2000) as a loading control .

• Immunohistochemistry (IHC): For assessing protein expression and localization in tissue samples, as validated in databases like the Human Protein Atlas .

• RNA Sequencing: For comprehensive transcriptomic analysis, often used in conjunction with TCGA datasets for validation purposes .

• ELISA: For quantitative protein detection, particularly useful for the recombinant protein analysis .

How is recombinant Pongo abelii SLC31A1 typically produced and stored?

Recombinant Pongo abelii SLC31A1 is typically produced in expression systems optimized for mammalian membrane proteins. The recombinant protein is often supplied in quantities of 50 μg, stored in a Tris-based buffer with 50% glycerol to maintain stability . For optimal preservation, the protein should be stored at -20°C, with extended storage recommended at either -20°C or -80°C . Repeated freeze-thaw cycles should be avoided, and working aliquots can be maintained at 4°C for up to one week . The expression region typically includes amino acids 1-190, representing the full-length protein .

What are the key experimental considerations when studying SLC31A1 mutations?

When investigating SLC31A1 mutations, researchers should consider several critical factors:

• Mutation Location and Functional Impact: Key residues such as Arg95, Arg102, and His120 have been identified as critically important, with mutations at these positions associated with neurodevelopmental disorders . The His120 residue is particularly significant, being located in close proximity to the HCH domain—a crucial region for copper binding and transport .

• Structural Analysis: The trimeric structure of CTR1 forms a pore, with specific residues (Arg95 and Arg102) located at the "gate" of this pore . Mutations affecting the quaternary structure may significantly impact function without obviously affecting protein expression levels.

• Mitochondrial Function Assessment: SLC31A1 mutations have been associated with impaired mitochondrial respiration . High-resolution respirometry should be considered to evaluate the functional impact of mutations on cellular bioenergetics.

• Copper Transport Assays: Since SLC31A1 is central to copper uptake, assays measuring intracellular copper levels (such as atomic absorption spectroscopy or fluorescent copper probes) should be employed to assess functional consequences of mutations.

• Clinical Correlation: Bi-allelic SLC31A1 mutations have been associated with early-onset epileptic encephalopathy, severe neurodevelopmental delay, and hypotonia . Researchers should correlate molecular findings with clinical manifestations.

How can SLC31A1 expression be effectively modulated in experimental models?

Several methodologies have been established for modulating SLC31A1 expression in research settings:

1. siRNA Knockdown
The following validated siRNA sequence has been used successfully for SLC31A1 knockdown in cell models:

• Sense strand: 5′-CACAAAACUGUUGGGCAAC-3′

• Antisense strand: 5′-GUUGCCCAACAGUUUUGUG-3′

Transfection protocols typically utilize LipofectamineTM 3000 (Invitrogen) following manufacturer's recommendations, with appropriate negative controls (e.g., siNC) included .

2. CRISPR-Cas9 Gene Editing
For more permanent genetic modifications, CRISPR-Cas9 targeting of SLC31A1 can be employed, with guide RNAs designed to target conserved exonic regions.

3. Overexpression Models
Plasmid-based overexpression systems can be utilized to study gain-of-function phenotypes, though researchers should note that excess copper accumulation in cells overexpressing CTR1 indicates it is a limiting factor for cellular copper acquisition .

What is the role of SLC31A1 in cancer development and progression?

Recent research has revealed significant associations between SLC31A1 and cancer pathophysiology:

What methodological approaches are recommended for investigating SLC31A1-related neurodevelopmental disorders?

When researching SLC31A1's role in neurodevelopmental conditions, several complementary approaches are recommended:

• Genetic Screening: Next Generation Sequencing (NGS) to identify bi-allelic SLC31A1 variants, with particular attention to hotspot mutations such as p.His120Gln and p.(Arg102Cys/His), which have been identified in multiple cases .

• Clinical Phenotyping: Comprehensive clinical characterization including neuroimaging to assess brain atrophy and white matter abnormalities, which are common findings in affected individuals .

• Functional Validation: RNA sequencing to evaluate gene expression changes and Western blotting to assess CTR1 protein levels in patient-derived samples .

• Mitochondrial Function: High-resolution respirometry to measure mitochondrial respiratory capacity, which has been shown to be impaired in patient fibroblasts .

• Animal Models: Development of transgenic models harboring SLC31A1 mutations to study neurological phenotypes and potential therapeutic interventions.

• Structural Biology: Analysis of how specific mutations affect the structure of CTR1, particularly focusing on the trimeric assembly and pore formation essential for copper transport .

What are the interactions between SLC31A1 and other copper homeostasis proteins?

SLC31A1 functions within a complex network of proteins involved in copper homeostasis:

• Intracellular Copper Chaperones: After uptake via SLC31A1, copper ions are bound by cytosolic copper chaperones like ATOX1, CCS, and COX17, which deliver copper to specific cellular compartments.

• Copper-Transporting ATPases: ATP7A and ATP7B work in conjunction with SLC31A1 to maintain appropriate copper levels, with ATP7A primarily involved in copper efflux from enterocytes and ATP7B important for hepatic copper excretion.

• Metallothioneins: These cysteine-rich proteins bind excess intracellular copper and provide a buffering system that complements the transport functions of SLC31A1.

• Redox Signaling: Recent research has unveiled that CTR1 can act as a redox sensor, driving neovascularization , suggesting interactions with redox-sensitive signaling pathways.

• Immune Checkpoint Regulation: A compelling connection has been observed between CTR1 and Programmed death-ligand 1, prompting clinical trials evaluating copper chelators as potential immune checkpoint inhibitors .

The coordinated action of these proteins ensures precise control of copper levels, with dysfunction in any component potentially disrupting the entire system.

How can recombinant Pongo abelii SLC31A1 be utilized in drug discovery and screening?

Recombinant Pongo abelii SLC31A1 offers several advantages for drug discovery applications:

• High-Throughput Screening: The availability of purified recombinant protein enables the development of biochemical assays for screening compound libraries to identify modulators of SLC31A1 function.

• Structure-Based Drug Design: With detailed structural information about the copper binding sites and transport mechanism, rational design of small molecules that specifically target SLC31A1 becomes feasible.

• Ortholog Comparison: Studying the Pongo abelii variant alongside human SLC31A1 can provide insights into conserved functional domains and species-specific differences, potentially identifying critical regions for therapeutic targeting.

• Antibody Development: Recombinant protein can be used to generate and validate specific antibodies for diagnostic or therapeutic applications.

• Transport Assays: Reconstitution of the recombinant protein in liposomes or other membrane systems allows for direct measurement of transport activity and its modulation by candidate drugs.

What are the current technical challenges in studying SLC31A1 function?

Researchers face several significant technical challenges when investigating SLC31A1:

• Membrane Protein Expression: As a transmembrane protein, SLC31A1 presents challenges for expression and purification while maintaining native conformation and function.

• Functional Assays: Developing reliable assays that directly measure copper transport activity rather than simply protein expression or localization remains technically demanding.

• Physiological Relevance: In vitro systems may not fully recapitulate the complexity of copper homeostasis networks present in vivo, necessitating careful validation of experimental findings.

• Redundancy and Compensation: Other copper transport systems may compensate for SLC31A1 dysfunction in experimental models, potentially masking phenotypes.

• Tissue-Specific Effects: The varying importance of SLC31A1 across different tissues requires thoughtful experimental design to capture tissue-specific functions and pathologies.

• Distinguishing Direct vs. Indirect Effects: Given copper's role as a cofactor for numerous enzymes, distinguishing direct consequences of SLC31A1 dysfunction from secondary effects of altered copper homeostasis presents a significant challenge.