Recombinant Pongo abelii Palmitoyltransferase ZDHHC13 (ZDHHC13)

What is ZDHHC13 and what is its fundamental function?

ZDHHC13 is a member of the DHHC-containing palmitoyl acyltransferases (PATs) family that catalyzes protein S-palmitoylation, a reversible post-translational modification involving the addition of a 16-carbon palmitate to proteins through a thioester linkage . This modification alters protein hydrophobicity, subcellular localization, and protein-protein interactions. In Pongo abelii (Sumatran orangutan), ZDHHC13 is encoded by the ZDHHC13 gene, which produces transcript variants as indicated in the NCBI database . The enzyme contains a characteristic DHHC domain that is essential for its catalytic activity, as demonstrated by studies showing that mutations in this domain (such as D453A, Q454A) abolish its palmitoylation function .

How is the structure of ZDHHC13 conserved across species?

While the detailed crystal structure of Pongo abelii ZDHHC13 has not been fully characterized, comparative genomic analyses show significant conservation across primates and other mammals. The ZDHHC13 gene in Pongo abelii produces multiple transcript variants, including ZDHHC13 transcript variant X3 and X4 as documented in GenScript's ORF clone database . Functional studies in mouse models have demonstrated that the catalytic DHHC domain is highly conserved, as mutations in this region (such as the L203X nonsense mutation) lead to premature protein truncation and loss of enzymatic activity . The functional conservation is further evidenced by the similar phenotypes observed in various species with ZDHHC13 deficiency, including abnormalities in bone formation, hair growth, and neurological function.

What experimental models are most suitable for studying ZDHHC13 function?

Multiple experimental models have proven valuable for investigating ZDHHC13 function:

• Mouse models: The luc mouse model carrying a recessive nonsense mutation (L203X) in Zdhhc13 displays phenotypes including hypotrichosis, osteoporosis, and amyloidosis, making it valuable for studying the systemic effects of ZDHHC13 deficiency . Notably, at 3 months of age, these mutant mice exhibit increased sensorimotor gating, anxiety, hypoactivity, and decreased motor coordination compared to controls .

• Cell culture systems: HEK293 cells have been effectively used for overexpression studies to investigate substrate interactions and palmitoylation activities . Additionally, HeLa cells and murine neuronal progenitor striatal cells (NPC) have been employed to examine the impact of ZDHHC13 deficiency on mitochondrial dynamics and function .

• CRISPR-Cas9 knockout lines: Multiple ZDHHC13 knockout cell lines have been generated to study autophagy flux, demonstrating consistent reduction in autophagy across five independent knockout lines .

• siRNA knockdown systems: Targeted siRNA approaches against ZDHHC13 have effectively demonstrated its role in autophagy regulation, with rescue experiments using siRNA-resistant ZDHHC13 confirming specificity of the observed effects .

What techniques are available for detecting ZDHHC13-mediated protein palmitoylation?

Several complementary approaches can be utilized to detect and quantify ZDHHC13-mediated protein palmitoylation:

• Acyl-Biotin Exchange (ABE): This method has been successfully used to evaluate the palmitoylation level of MT1-MMP, a direct substrate of ZDHHC13 . The technique involves replacing palmitoyl modifications with biotin, allowing for the selective isolation and detection of palmitoylated proteins. In studies with MT1-MMP-V5 co-expressed with ZDHHC13, this method revealed approximately 2-fold higher palmitoylation levels with wild-type ZDHHC13 compared to mutant constructs .

• Metabolic labeling: Incorporation of radioactive palmitate (³H-palmitate) or clickable palmitate analogs (17-ODYA) can be used to track newly palmitoylated proteins in cell culture systems expressing recombinant ZDHHC13.

• Palmitoylation inhibitors and mutagenesis: Experimental designs incorporating the palmitoylation inhibitor 2-bromopalmitate (2-BP) alongside site-directed mutagenesis of potential palmitoylation sites (as demonstrated with cysteine 574 of MT1-MMP) provide robust validation of ZDHHC13-mediated palmitoylation .

• Co-immunoprecipitation: This technique can be used in conjunction with ABE to confirm physical interactions between ZDHHC13 and its substrates before assessing palmitoylation status .

How can novel substrates of ZDHHC13 be identified and validated?

A multi-tiered approach is recommended for the identification and validation of novel ZDHHC13 substrates:

• Proteomics screening: Comparative palmitoyl-proteomics between wild-type and ZDHHC13-deficient samples (using ABE or metabolic labeling coupled with mass spectrometry) can identify proteins with differential palmitoylation status.

• Bioinformatic prediction: Analysis of protein sequences for consensus palmitoylation motifs, coupled with structural modeling of potential substrate interactions with the ZDHHC13 catalytic domain.

• Validation through direct biochemical assays: Confirmation of direct palmitoylation using in vitro assays with purified recombinant ZDHHC13 and candidate substrates, followed by ABE or click chemistry approaches.

• Functional validation in cellular systems: Assessment of the functional consequences of mutation of the predicted palmitoylation sites in candidate substrates, as demonstrated with MT1-MMP and ULK1 .

• In vivo confirmation: Analysis of palmitoylation status in tissues from wild-type versus ZDHHC13-deficient animals, as performed with MT1-MMP in epiphyses of wild-type and mutant mice, which revealed a reduction from 70% to 40% palmitoylation in mutant tissues .

What expression systems are optimal for producing recombinant Pongo abelii ZDHHC13?

Based on the available research data, several expression systems have demonstrated efficacy:

• Mammalian expression systems: HEK293 cells have been successfully used for co-expression studies with ZDHHC13 and its substrates . These systems maintain proper post-translational modifications and appropriate subcellular localization.

• Rescue constructs: For functional studies, siRNA-resistant ZDHHC13 wild-type constructs have been effectively used to restore function in knockdown cells, while catalytic mutants (D453A, Q454A) fail to rescue, confirming the specificity of the enzymatic function .

• Tagged constructs: ZDHHC13-mNeonGreen (mNG) fusion proteins maintain functionality and allow for visualization of subcellular localization .

• Vectors and cloning strategies: For RNA probe generation, the PCR product (501 bp) generated with primers specific to mouse Zdhhc13 (Forward: GGGCCATCCGACAAGGGCAT, and Reverse: TGTGCAGCCATCGCCAAAGC) has been successfully cloned into pGEM-T Easy vector for expression .

How does ZDHHC13 regulate bone development and homeostasis?

ZDHHC13 plays a crucial role in skeletal development and bone mass acquisition through several mechanisms:

• Palmitoylation of MT1-MMP: ZDHHC13 directly palmitoylates MT1-MMP (membrane type 1-matrix metalloproteinase), which affects its subcellular distribution and downstream signaling . In Zdhhc13 mutant mice, reduced MT1-MMP palmitoylation correlates with decreased expression of VEGF in hypertrophic chondrocytes and osteocalcin at the cartilage-bone interface .

• Developmental timeline of bone abnormalities: While body size, skeletal structure, and trabecular bone are similar in Zdhhc13 wild-type and mutant mice at birth, growth retardation and delayed secondary ossification center formation become evident by day 10. By 4 weeks, disorganization in growth plate structure and osteoporosis are apparent .

• Quantitative bone phenotype progression: Serial microCT analyses of mice from 4-20 weeks of age reveal progressively reduced bone mineral density in Zdhhc13 mutant mice compared to wild-type controls .

The following table summarizes key bone-related findings in Zdhhc13-deficient mouse models:

What is the role of ZDHHC13 in autophagy regulation?

ZDHHC13 has recently been identified as a critical regulator of multiple aspects of autophagy:

• ULK1 palmitoylation: ZDHHC13 palmitoylates ULK1 (Unc-51 Like Autophagy Activating Kinase 1), which is essential for recruiting the ULK1 complex to autophagosome formation sites .

• Impact on autophagy flux: Knockdown or knockout of ZDHHC13 inhibits autophagy flux as demonstrated by both tfLC3 assay and pulse-chase reporter processing assay using Halo-LC3 .

• Effect on autophagosome formation proteins: ZDHHC13 knockdown strongly inhibits the puncta formation of LC3, ATG5, ULK1, and WIPI1, indicating its role in early autophagosome formation .

• Regulation of selective autophagy: Beyond starvation-induced autophagy, ZDHHC13 is required for selective autophagy processes including mitophagy and lysophagy . In ZDHHC13 knockdown cells, impaired clearance of damaged lysosomes was observed after LLOMe treatment .

• Independence from mTOR signaling: While ULK1 typically functions downstream of mTOR, ZDHHC13's effect on autophagy appears to be independent of mTOR activity, as phosphorylation levels of mTOR substrates (p70S6K, ULK1, TFEB) respond normally to starvation in ZDHHC13 knockdown cells .

How does ZDHHC13 influence mitochondrial dynamics and neurological function?

ZDHHC13 plays a significant role in mitochondrial dynamics and neurological function through several mechanisms:

• Drp1 palmitoylation: ZDHHC13 mediates the S-palmitoylation of Drp1 (Dynamin-related protein 1), a key regulator of mitochondrial fission . In Zdhhc13 mutant mice, reduced Drp1 palmitoylation in cortex and cerebellum is accompanied by altered mitochondrial dynamics .

• Metabolic alterations: Loss of Zdhhc13 results in increased glycolysis, glutaminolysis, and lactic acidosis, indicating significant metabolic reprogramming in neural tissues .

• Neurotransmitter imbalances: ZDHHC13 deficiency leads to neurotransmitter imbalances that may contribute to behavioral abnormalities .

• Behavioral phenotypes: At 3 months of age, Zdhhc13 mutant mice exhibit increased sensorimotor gating, anxiety, hypoactivity, and decreased motor coordination compared to controls . These findings suggest a role for ZDHHC13 in neurological function that may be relevant to conditions such as Huntington's disease, which has been linked to ZDHHC13 deficiency .

• Fission-fusion process: Through both in vivo and in vitro models, Zdhhc13-dependent Drp1 S-palmitoylation has been shown to enable the normal occurrence of the mitochondrial fission-fusion process, which is essential for maintaining cellular bioenergetics .

How can researchers address contradictory findings regarding ZDHHC13 substrate specificity?

When confronted with contradictory data regarding ZDHHC13 substrate specificity, consider these methodological approaches:

• Cross-validate using multiple detection methods: Combine complementary techniques (ABE, click chemistry, metabolic labeling) to confirm palmitoylation status. In published studies, ABE was validated using palmitoylation inhibitors (2-BP) and site-directed mutagenesis to confirm specificity .

• Control for experimental variables: Different cell types or tissues may express different cofactors or modulators of ZDHHC13 activity. Studies have shown that palmitoylation of MT1-MMP by ZDHHC13 accounts for approximately 30% of total MT1-MMP palmitoylation in vivo, suggesting other PATs may contribute to substrate modification in different contexts .

• Consider species-specific differences: While functional domains are conserved, subtle differences in ZDHHC13 between species (e.g., Pongo abelii vs. mouse) may affect substrate recognition. When possible, compare recombinant proteins from the same species as your experimental system.

• Evaluate catalytic versus structural roles: Some effects of ZDHHC13 may be independent of its palmitoylation activity. This distinction can be tested using catalytically inactive mutants (D453A, Q454A) as controls, as demonstrated in autophagy studies .

• Examine substrate-specific context: The cellular microenvironment may influence ZDHHC13-substrate interactions. For instance, ZDHHC13 overexpression did not significantly affect autophagy flux despite being necessary for normal autophagy, suggesting context-dependent regulation .

What controls are essential for experiments using recombinant ZDHHC13?

Robust experimental design with appropriate controls is crucial for ZDHHC13 research:

• Catalytic domain mutants: Include catalytically inactive mutants (D453A, Q454A) to distinguish between palmitoylation-dependent and independent effects .

• Rescue experiments: For knockdown studies, include rescue with siRNA-resistant wild-type ZDHHC13 to confirm specificity, as demonstrated in GFP-LC3 puncta formation assays .

• Palmitoylation inhibitors: Include 2-bromopalmitate (2-BP) treatment as a negative control to confirm that observed effects are specifically due to palmitoylation .

• Substrate site mutants: Validate specific palmitoylation sites through site-directed mutagenesis of candidate cysteine residues, as shown with cysteine 574 of MT1-MMP .

• Expression level normalization: When comparing wild-type and mutant ZDHHC13 constructs, carefully monitor protein expression levels as variations can confound interpretation of functional differences .

• Cross-species validation: When studying Pongo abelii ZDHHC13, compare results with data from other species to confirm evolutionary conservation of function.

How can researchers differentiate between direct and indirect effects of ZDHHC13 manipulation?

Differentiating direct from indirect effects requires systematic experimental approaches:

• In vitro reconstitution: Using purified recombinant proteins to demonstrate direct palmitoylation in a cell-free system.

• Temporal analyses: Monitoring the kinetics of cellular changes following ZDHHC13 manipulation to distinguish primary from secondary effects. For example, studies tracking the progression of bone abnormalities in Zdhhc13 mutant mice from birth to 20 weeks revealed that abnormalities became apparent only after day 10, suggesting secondary developmental effects .

• Substrate-specific rescue: Expressing pre-palmitoylated forms of putative substrates (or palmitoylation-mimicking constructs) in ZDHHC13-deficient backgrounds to determine if they rescue specific phenotypes.

• Pathway analysis: Systematically testing components of affected pathways to map direct targets. For example, examining ULK1 complex formation and localization in ZDHHC13 knockdown cells helped establish ULK1 as a direct target .

• Multi-omics approaches: Combining proteomics, transcriptomics, and metabolomics to create comprehensive models of ZDHHC13-dependent networks and identify primary nodes.

What are the emerging applications of Pongo abelii ZDHHC13 in comparative evolutionary studies?

Pongo abelii ZDHHC13 offers unique opportunities for evolutionary studies:

• Comparative substrate preferences: Systematic comparison of substrate recognition and palmitoylation efficiency between ZDHHC13 orthologs from different primates could reveal evolutionary adaptations in protein modification systems.

• Regulatory evolution: Analysis of transcriptional and post-transcriptional regulation of ZDHHC13 across primate species may provide insights into the evolution of tissue-specific expression patterns.

• Structural determinants of function: Comparative structural analysis of ZDHHC13 from Pongo abelii and other species could identify conserved and divergent features that influence substrate specificity and catalytic efficiency.

• Disease-related variants: Cross-species analysis of disease-associated ZDHHC13 variants may help predict functional consequences and evolutionary constraints on the enzyme.

• Ecological adaptations: Investigation of potential species-specific adaptations in ZDHHC13 function related to unique physiological or environmental challenges faced by Pongo abelii.

How might ZDHHC13 research inform therapeutic approaches for related pathologies?

Understanding ZDHHC13 function has potential therapeutic implications:

• Osteoporosis interventions: Since ZDHHC13-mediated MT1-MMP palmitoylation is a key modulator of bone homeostasis, targeted modulation of this pathway could provide novel approaches for treating osteoporosis .

• Neurodegenerative disease therapies: Given the link between ZDHHC13 deficiency and Huntington's disease-like phenotypes, as well as its role in mitochondrial dynamics, targeting ZDHHC13-dependent pathways might offer therapeutic avenues for neurodegenerative conditions .

• Autophagy modulation: ZDHHC13's critical role in autophagy through ULK1 palmitoylation suggests potential targets for interventions in diseases with dysregulated autophagy, including cancer and neurodegeneration .

• Palmitoylation-targeted drug design: Development of small molecules that selectively modulate ZDHHC13 activity or substrate-specific palmitoylation could provide precise tools for therapeutic intervention.

• Biomarker development: Changes in palmitoylation profiles of ZDHHC13 substrates might serve as biomarkers for disease progression or treatment response.