TP53I11 is transcriptionally regulated by TP53 and modulates cellular responses to DNA damage:
Apoptosis Regulation: TP53I11 enhances TP53-dependent apoptosis in response to genotoxic stressors like mitomycin C and UV-C . Knockdown experiments in fibroblasts reduced TP53 signaling by 40–60% under DNA damage .
ER Calcium Modulation: TP53I11 influences endoplasmic reticulum Ca²⁺ levels, impacting cancer cell proliferation .
Cross-Species Conservation: Functional studies in mouse 3T3-L1 cells showed heterologous TP53I11 expression increased apoptosis sensitivity by 1.5–2.0-fold compared to controls .
Dual-Luciferase Reporter Assays: Used to quantify TP53 pathway activation via pGL4.38[ luc2p/p53 RE/Hygro] vectors .
siRNA Knockdown Studies: TP53I11-specific siRNAs (e.g., shTP53I11#1: GATCATGTGGAACGCTCTCTA) reduced TP53 signaling efficacy .
Protein Interaction Mapping: Direct interactions with ATXN1 suggest roles in neurodegenerative pathways .
KEGG: pon:100171701
UniGene: Pab.14094
TP53I11 (Tumor protein p53-inducible protein 11) is a p53-induced gene product also known as p53-induced gene 11 protein (PIG11). The protein is encoded by the TP53I11 gene, which is an early transcription-related target of p53 involved in cell apoptosis and tumor development . The gene has been identified in various species, including humans and non-human primates like Pongo abelii (Sumatran orangutan). In scientific literature, you may encounter this protein referred to by either its full name, the abbreviation TP53I11, or its synonym PIG11, depending on the research context and publication date .
TP53I11 plays critical roles in several cellular processes:
Calcium homeostasis regulation: TP53I11 is a key regulator of endoplasmic reticulum (ER) Ca²⁺ levels. Overexpression of TP53I11 leads to elevated ER Ca²⁺ levels, while knockdown results in decreased ER Ca²⁺ levels .
Cell proliferation control: As a p53 target gene, TP53I11 is involved in the regulation of cell proliferation, with evidence suggesting tumor suppressor properties in some cancer contexts .
Angiogenesis regulation: Recent research has revealed that TP53I11 is associated with endothelial cells and plays a significant role in tumor angiogenesis. It can promote angiogenic functions of human umbilical vein endothelial cells (HUVECs) in vitro .
Response to cellular stress: TP53I11 expression is upregulated in response to chemotherapeutic agents like doxorubicin (DOX), suggesting its involvement in stress-response pathways .
TP53I11 serves as a critical regulator of endoplasmic reticulum (ER) Ca²⁺ homeostasis. Research has demonstrated that:
Mechanistic action: TP53I11 functions downstream of multiple microRNAs in the regulation of ER Ca²⁺ levels. When TP53I11 is downregulated by these miRNAs, basal ER Ca²⁺ levels decrease significantly .
Experimental evidence: Ca²⁺ imaging studies in both HEK293 and HeLa cell lines have shown that knockdown of TP53I11 using shRNA constructs (particularly shTP53I11#1) results in a significant reduction in the TuNer-s ratio, indicating decreased ER Ca²⁺ levels. Conversely, overexpression of TP53I11 leads to a notable increase in basal ER Ca²⁺ levels .
Downstream effects: The alteration of ER Ca²⁺ levels by TP53I11 has profound effects on cellular processes, including:
Cell proliferation rates, particularly in cancer cells
Potential influence on ER stress responses
Modulation of Ca²⁺-dependent signaling pathways
Therapeutic implications: The ability of TP53I11 to elevate ER Ca²⁺ levels, particularly when upregulated by chemotherapeutic agents like doxorubicin, suggests a novel therapeutic mechanism whereby increasing ER Ca²⁺ accumulation could enhance anticancer efficacy .
TP53I11 exhibits complex and tissue-specific relationships with cancer prognosis:
This pan-cancer analysis reveals the context-dependent nature of TP53I11's impact on cancer outcomes. The variation in prognostic significance may be related to tissue-specific functions of TP53I11, differences in regulatory networks, or the tumor microenvironment in different cancer types .
TP53I11 undergoes multiple levels of regulation in cancer:
DNA methylation: There is a negative correlation between TP53I11 expression and DNA methylation in most cancer types, suggesting epigenetic regulation as a key mechanism controlling TP53I11 levels .
Post-translational modifications: The S14 residue of TP53I11 is phosphorylated in several cancer types, indicating potential regulation through phosphorylation that may affect protein function, stability, or interactions .
microRNA regulation: Multiple microRNAs target TP53I11 mRNA for degradation or translational repression. Research has identified at least 10 miRNAs that significantly lower TP53I11 expression, including hsa-miR-210-3p, hsa-miR-210-5p, and hsa-miR-645. This represents an important post-transcriptional regulatory mechanism .
Hypoxia-induced regulation: TP53I11 is transcriptionally upregulated by HIF2A under hypoxic conditions, which connects its expression to the tumor microenvironment and oxygen availability .
p53-dependent regulation: As its name suggests, TP53I11 is a p53-inducible gene. The functional status of p53 in cancer cells therefore directly impacts TP53I11 expression levels .
For optimal storage and handling of recombinant Pongo abelii TP53I11:
Storage temperature:
Buffer composition:
Avoiding degradation:
Handling precautions:
Maintain sterile conditions when handling the protein
Follow standard protein handling protocols to prevent contamination and degradation
Consider the addition of protease inhibitors if working with cell lysates or during extended experimental procedures
Several experimental approaches have been validated for studying TP53I11's role in ER Ca²⁺ regulation:
Ca²⁺ imaging using TuNer-s system:
The TuNer-s (Tune Endoplasmic Reticulum sensors) ratio provides a quantitative measure of ER Ca²⁺ levels
This fluorescent protein-based approach allows real-time monitoring of ER Ca²⁺ in living cells
Both basal levels and dynamic changes in ER Ca²⁺ can be measured in response to TP53I11 manipulation
Genetic manipulation approaches:
shRNA knockdown: Design specific shRNAs targeting TP53I11 (e.g., shTP53I11#1) and confirm knockdown efficiency through RT-qPCR
Overexpression: Transfect cells with TP53I11 expression vectors and confirm through Western blot
CRISPR/Cas9 knockout: Generate complete knockout cell lines for more definitive functional studies
Pharmacological interventions:
RT-qPCR and Western blot analysis:
To investigate TP53I11's role in angiogenesis, researchers can employ the following validated in vitro approaches:
Microvessel sprouting assay:
Tube formation assay:
Endothelial cell proliferation assay:
Migration assay:
Hypoxia experiments:
When conducting pan-cancer analysis of TP53I11 expression and its clinical correlations, consider the following methodological approaches:
Expression analysis across cancer types:
Compare TP53I11 expression between tumor and normal tissues across multiple cancer types
Use standardized datasets like TCGA for consistency
Apply appropriate normalization methods to account for batch effects
Present results in a comparative visualization showing expression patterns across cancer types
Survival analysis methodology:
Stratify patients into high and low TP53I11 expression groups (median split or optimal cutpoint)
Generate Kaplan-Meier survival curves for each cancer type
Calculate hazard ratios with 95% confidence intervals
Perform multivariate analysis to control for confounding factors (age, stage, grade)
Be aware that TP53I11's impact varies by cancer type - beneficial in some (KIRC) but detrimental in others (BRCA, KIRP, MESO, UVM)
Correlation with molecular features:
Interpretation frameworks:
Consider tissue-specific contexts when interpreting results
Integrate findings with known biological functions (ER Ca²⁺ regulation, angiogenesis)
Acknowledge limitations in correlative studies vs. causal relationships
When investigating TP53I11's role in calcium homeostasis, researchers should be aware of these potential pitfalls and their solutions:
The development of TP53I11-targeted therapies for cancer represents a promising research direction, with several potential approaches:
Direct TP53I11 modulation strategies:
For cancers where high TP53I11 is detrimental (BRCA, KIRP, MESO, UVM): Develop small molecule inhibitors or targeted antibodies against TP53I11
For cancers where TP53I11 acts as a tumor suppressor: Design approaches to upregulate or stabilize TP53I11 expression, potentially through epigenetic modulators targeting its promoter methylation
ER Ca²⁺ homeostasis as a therapeutic target:
Anti-angiogenic approach:
microRNA-based therapeutics:
Despite recent advances, several key questions about TP53I11's role in angiogenesis remain unresolved:
Molecular mechanism of action:
Context-dependent effects:
Interaction with established angiogenic pathways:
In vivo validation:
Translational potential:
Can TP53I11 serve as a biomarker for response to anti-angiogenic therapies?
Would tumors with high TP53I11 expression show greater sensitivity to drugs targeting HIF2A or calcium homeostasis?
Could circulating levels of TP53I11 correlate with tumor angiogenic activity?
Integration of multi-omics approaches offers powerful opportunities to advance TP53I11 research:
Genomics and epigenomics integration:
Transcriptomics applications:
RNA-seq analysis to identify genes co-regulated with TP53I11
Alternative splicing analysis to detect potential isoforms with distinct functions
Single-cell transcriptomics to map TP53I11 expression in heterogeneous tumor microenvironments
Proteomics and interactomics:
Identification of TP53I11 binding partners through immunoprecipitation-mass spectrometry
Phosphoproteomic analysis to characterize the significance of S14 phosphorylation and identify other post-translational modifications
Protein-protein interaction networks to place TP53I11 in broader cellular signaling pathways
Metabolomics considerations:
Analysis of metabolic changes associated with TP53I11 manipulation
Focus on calcium-dependent metabolic pathways
Investigation of potential links between TP53I11, calcium homeostasis, and cellular metabolism
Integrative analysis frameworks:
Machine learning approaches to integrate multi-omics data and predict TP53I11 function in different contexts
Network analysis to position TP53I11 within cellular signaling networks
Systems biology modeling of TP53I11's role in calcium homeostasis and angiogenesis