Recombinant Rat C-C chemokine receptor type 5 (Ccr5)

What is Rat C-C Chemokine Receptor Type 5 (CCR5) and how does it function in rat models?

Rat CCR5 is a G protein-coupled receptor that functions as a chemokine receptor, playing a crucial role in immune cell migration and inflammatory responses. It acts as a receptor for several C-C motif chemokines, including CCL5 (also known as RANTES). In rat models, CCR5 mediates chemotaxis of specific immune cells, particularly monocytes and T cells, directing their migration to sites of inflammation . Functionally, rat CCR5 participates in multiple signaling pathways including the chemokine signaling pathway and cytokine-cytokine receptor interaction . The receptor is primarily expressed on CD4+ T lymphocytes, macrophages, and microglia, making it an important component of both adaptive and innate immune responses in rat experimental models .

What are the primary ligands for rat CCR5 and their biological significance?

The primary ligand for rat CCR5 is CCL5 (RANTES), a 7.9 kDa protein that functions as a chemoattractant for peripheral blood monocytes and selectively attracts T cells of the CD4+/CD45RO+ phenotype . Rat CCL5 produces chemotaxis over a wide concentration range, with significant chemotactic activity observed at concentrations of 10-50 ng/ml in assays using rat peritoneal macrophages . Other ligands include viral chemokines such as r129 from rat cytomegalovirus (RCMV), which has been shown to bind to rat CCR5 along with CCR3, CCR4, and CCR7 . The interaction between these ligands and rat CCR5 has biological significance in inflammatory responses, transplant rejection processes, and viral infections, highlighting the receptor's importance in both physiological and pathological conditions .

How do rat and human CCR5 compare structurally and functionally?

While rat and human CCR5 share considerable homology, there are important structural and functional differences that researchers must consider. Both serve as chemokine receptors and bind similar ligands including CCL5, but they exhibit species-specific binding affinities and downstream signaling characteristics. A key functional difference is their role in viral infections—human CCR5 serves as a co-receptor for HIV-1 entry into cells, while native rat CCR5 does not support HIV-1 infection .

This species difference has led to the development of transgenic rats expressing human CCR5 for HIV research. In these transgenic models, expression of human CCR5 alongside human CD4 renders rat cells susceptible to infection by R5 strains of HIV-1, demonstrating that the species-specific restriction occurs at the receptor level rather than in downstream cellular processes . Studies with these transgenic models have shown that cells from the monocyte/macrophage lineage expressing human CCR5 can be productively infected at levels one to two orders of magnitude higher than those described for comparable transgenic mouse models .

What are the optimal methods for generating transgenic rats expressing CCR5?

The generation of transgenic rats expressing CCR5 (particularly human CCR5 for HIV research) involves several key methodological steps:

• Vector Construction: Design a transgenic vector that ensures expression in target cell types. For example, to ensure expression in T helper cells and monocyte/macrophage lineage cells, researchers have used:

  • An 8.4-kb fragment from intron 1 of the human CD4 gene containing a monocyte-specific enhancer

  • The CD4 silencer element

  • The CCR5 cDNA inserted into the appropriate site in exon 2

• Transgenic Generation: Microinjection of the vector DNA into male pronuclei of fertilized oocytes from outbred rats (e.g., Sprague-Dawley rats)

• Founder Identification: Screen potential founders through:

  • PCR analysis of tail DNA samples using internal primers specific for the CCR5 cDNA sequence (e.g., 5′ primer: TCACTATGCTGCCGCCC, 3′ primer: AAACCAAAGTCCCACTGGGCG)

  • Flow cytometry analysis of peripheral blood samples to confirm expression of the human protein

• Validation of Expression: Confirm appropriate expression patterns using flow cytometry with fluorochrome-conjugated monoclonal antibodies against CCR5 and cell-specific markers

This methodology ensures the generation of transgenic rats with reliable expression of CCR5 in appropriate cell types, creating valuable models for studying chemokine receptor function and viral infections.

What protocols are recommended for assessing CCR5-mediated chemotaxis in rat cells?

For studying CCR5-mediated chemotaxis in rat cells, the following methodological approach is recommended:

• Cell Preparation:

  • For splenocytes: Enrich CD4+ cells from rat spleen using appropriate magnetic bead separation techniques

  • For macrophages: Culture peritoneal macrophages or bone marrow-derived macrophages according to standard protocols

• Chemotaxis Assay Setup:

  • Use Transwell® plates with appropriate pore size (3 μm for lymphocytes, 5-8 μm for macrophages)

  • Place cells in the upper chamber (typically 1-5 × 10^5 cells in serum-free medium)

  • Add chemokines (e.g., recombinant CCL5) to the lower chamber at concentrations ranging from 1-100 ng/ml

• Assay Conditions:

  • Incubate at 37°C with 5% CO2 for 2-4 hours

  • For optimal chemotaxis of rat cells responding to CCL5, concentrations of 10-50 ng/ml have been shown to induce significant migration

• Quantification:

  • Count migrated cells in the lower chamber using flow cytometry or hemocytometer

  • Calculate chemotactic index as the ratio of cells migrating in response to chemokine versus medium alone

  • For complete characterization, perform dose-response experiments with concentration ranges of 1-100 ng/ml

This protocol enables reliable quantification of CCR5-mediated chemotaxis in various rat cell populations and can be modified to study inhibitors or specific signaling pathways.

How should recombinant rat CCR5 protein be reconstituted and stored for optimal activity?

Based on established protocols for similar recombinant rat chemokine proteins, the following guidelines are recommended for reconstitution and storage of recombinant rat CCR5:

• Reconstitution:

  • Lyophilized protein should be reconstituted in sterile water or appropriate buffer

  • Prepare stock solutions at concentrations of 50-100 μg/ml

  • For functional assays, further dilutions should be made in buffer containing carrier protein (0.1-1% BSA) or medium containing serum to prevent adsorption to plastic surfaces

• Storage Conditions:

  • The lyophilized protein, while stable at room temperature for short periods, should be stored desiccated below 0°C for long-term stability

  • Reconstituted protein should be stored in working aliquots at -20°C to -80°C

  • Avoid repeated freeze-thaw cycles as they may lead to protein denaturation and loss of activity

• Stability Considerations:

  • Aliquots stored at -80°C typically maintain activity for at least 6-12 months

  • For working solutions, prepare fresh dilutions from frozen stocks for each experiment

  • Monitor protein activity periodically using functional assays to ensure consistent performance

Following these guidelines will help ensure optimal activity and reproducibility in experiments utilizing recombinant rat CCR5 protein.

How can rat CCR5 be utilized in models of transplant rejection and vascular disease?

Rat CCR5 plays a significant role in transplant rejection models, particularly in the development of transplant vascular sclerosis (TVS). Researchers can utilize rat CCR5 in these models through several approaches:

• Transplant Models:

  • Heart transplant models in rats can be used to study the role of CCR5 in transplant rejection

  • CCR5-mediated cell recruitment contributes to both acute and chronic rejection processes

  • Allogeneic grafts show upregulation of chemokines that interact with CCR5 at all stages post-transplantation

• Intervention Strategies:

  • CCR5 antagonists can be tested in rat transplant models to evaluate their potential to reduce rejection

  • Viral chemokine mutants (such as r129-ΔNT) that act as dominant negatives by inhibiting migration induced by wild-type chemokines can prevent CMV-induced acceleration of TVS

  • These approaches provide mechanistic insights into how CCR5-mediated cell recruitment contributes to transplant rejection

• Assessment Methods:

  • Histological analysis of graft tissue for cellular infiltration

  • Immunohistochemistry to detect CCR5 expression in infiltrating cells

  • Measurement of intimal thickening and vascular changes characteristic of TVS

  • Correlation of CCR5 expression with rejection severity and vascular pathology

This research area is particularly valuable as it has demonstrated that long-term graft acceptance is associated with the absence of chemokines, substantiating a major role for chemokines and their receptors like CCR5 in allogeneic graft rejection and TVS .

What are the methodological considerations for studying CCR5 in rat models of viral infection?

Studying CCR5 in rat models of viral infection requires specific methodological considerations:

• Model Selection:

  • Transgenic rats expressing human CD4 and CCR5 provide valuable platforms for studying HIV-1 infection

  • These models allow investigation of viral entry, replication dynamics, and host responses in a physiologically relevant context

• Infection Protocols:

  • For in vivo infections, anesthetize rats using isoflurane

  • Administer virus via tail vein cannulation (intravenous) or peritoneal cavity injection (intraperitoneal) using appropriate catheter systems

  • Use well-characterized viral stocks with known titers and tropism (e.g., R5 HIV-1 strains like YU-2)

• Assessment of Viral Infection:

  • Monitor plasma viremia through quantitative PCR of viral RNA

  • Detect viral DNA in tissues through PCR amplification of specific viral sequences

  • Analyze integration events using specialized PCR techniques that amplify host-virus junctions

  • For transgenic models expressing GFP-tagged viruses, use flow cytometry to detect infected cells

• Tissue Analysis:

  • Sample collection from spleen, thymus, and blood at defined timepoints

  • Process samples for detection of:

    • Episomal 2-LTR circles (markers of recent infection)

    • Integrated provirus (using primers specific for HIV-1 LTR sequences)

    • Viral gene expression (through RT-PCR or protein detection)

These methodological approaches enable comprehensive evaluation of viral infection dynamics and the role of CCR5 in viral pathogenesis in rat models.

What techniques are available for quantifying rat CCR5 expression and distribution in different tissues?

Several techniques are available for quantifying rat CCR5 expression and distribution across tissues:

• Flow Cytometry:

  • Use fluorochrome-conjugated monoclonal antibodies specific for rat CCR5

  • Analyze expression in combination with lineage markers to identify specific cell populations

  • Typical antibody panels include anti-CCR5 combined with markers like CD3, CD4, CD8a, CD11b/c, and CD45RA

  • This approach allows quantification of receptor density and percentage of positive cells

• RT-qPCR:

  • Extract RNA from tissues or sorted cell populations

  • Perform reverse transcription and quantitative PCR using primers specific for rat CCR5

  • Normalize expression to appropriate housekeeping genes

  • This technique provides sensitive quantification of mRNA expression levels

• Immunohistochemistry/Immunofluorescence:

  • Prepare tissue sections or cytospin preparations

  • Stain with anti-CCR5 antibodies and appropriate secondary detection systems

  • Combine with cell-type specific markers for colocalization studies

  • This approach preserves tissue architecture and allows visualization of receptor distribution

• Western Blotting:

  • Extract proteins from tissues or cells

  • Separate by SDS-PAGE and transfer to membranes

  • Probe with anti-CCR5 antibodies

  • This technique allows semi-quantitative analysis of protein expression

These complementary techniques provide comprehensive assessment of CCR5 expression patterns across different tissues and cell types in rat models, facilitating studies of receptor regulation under various physiological and pathological conditions.

How do rat models compare with other animal models for CCR5-related research?

Rat models offer distinct advantages and limitations compared to other animal models for CCR5-related research:

The advantage of transgenic rats expressing human CD4 and CCR5 is particularly notable, as these models show susceptibility to HIV-1 infection with expression of viral gene products comparable to human reference cultures. Importantly, primary rat macrophages and microglia from these transgenic models can be productively infected by various R5 strains of HIV-1 at levels one to two orders of magnitude higher than comparable transgenic mouse models .

What are the main challenges in interpreting CCR5 function across species barriers?

Interpreting CCR5 function across species barriers presents several significant challenges:

• Receptor-Ligand Specificity:

  • Species-specific differences in binding affinities between CCR5 and its ligands

  • Variations in chemokine structures across species affect receptor recognition

  • Different chemokine-receptor binding patterns may lead to activation of distinct signaling pathways

• Expression Patterns:

  • Cell type-specific and tissue-specific expression patterns may vary between species

  • Regulatory mechanisms controlling CCR5 expression can differ substantially

  • These differences impact interpretation of functional studies and disease models

• Viral Interactions:

  • Human CCR5 serves as a co-receptor for HIV-1, while native rat CCR5 does not

  • This fundamental difference necessitates the creation of transgenic models expressing human CCR5 for HIV research

  • Even in transgenic rats, species-specific cellular factors may influence viral replication post-entry

• Signaling Cascades:

  • Intracellular signaling pathways coupled to CCR5 may show species-specific variations

  • Differences in adapter proteins, kinases, and transcription factors can alter response patterns

  • These variations complicate direct translation of findings between species

These challenges highlight the importance of careful experimental design and species-appropriate controls when studying CCR5 function in different animal models.

What methodological approaches can address the limitations of using recombinant rat CCR5 in experimental systems?

Several methodological approaches can address limitations associated with using recombinant rat CCR5 in experimental systems:

• Expression System Optimization:

  • Use mammalian expression systems rather than bacterial or insect cell systems to ensure proper post-translational modifications

  • Include appropriate signal sequences and tags that don't interfere with receptor function

  • Validate receptor folding and membrane localization through functional assays

• Functional Reconstitution Strategies:

  • Incorporate recombinant CCR5 into lipid nanodisc platforms to maintain native-like membrane environment

  • Use cell-free expression systems coupled with artificial membranes

  • These approaches preserve receptor conformation and signaling capabilities

• Chimeric Receptor Approaches:

  • Generate chimeric receptors combining domains from rat and human CCR5 to map species-specific functions

  • Create chimeras with fluorescent proteins for real-time visualization of receptor trafficking

  • These constructs enable detailed structure-function analyses

• Complementary In Vivo Approaches:

  • Combine in vitro studies using recombinant CCR5 with in vivo validation in transgenic models

  • Use tissue-specific or inducible expression systems to control receptor expression

  • These strategies provide physiological context for interpreting in vitro findings

• Advanced Analytical Techniques:

  • Apply biophysical methods (SPR, ITC, etc.) to characterize ligand binding properties

  • Use cryo-EM or X-ray crystallography to determine structural features

  • Employ computational modeling to predict species-specific interaction differences

By implementing these methodological approaches, researchers can overcome many limitations associated with recombinant rat CCR5 studies and generate more reliable and translatable results.

What emerging technologies show promise for advancing rat CCR5 research?

Several emerging technologies show significant promise for advancing rat CCR5 research:

• CRISPR/Cas9 Gene Editing:

  • Generation of knock-in rats with tagged or modified CCR5

  • Creation of humanized rat models with improved fidelity to human receptor function

  • Development of conditional knockout systems for tissue-specific or temporal control of CCR5 expression

• Single-Cell Technologies:

  • Single-cell RNA sequencing to map CCR5 expression across diverse cell populations

  • Single-cell proteomics to correlate CCR5 protein levels with functional outcomes

  • These approaches provide unprecedented resolution of cellular heterogeneity in CCR5 biology

• Advanced Imaging Techniques:

  • Intravital multiphoton microscopy for real-time visualization of CCR5-expressing cells in living tissues

  • Super-resolution microscopy to study CCR5 clustering and interactions with signaling partners

  • These technologies enable dynamic analysis of receptor behavior in physiological contexts

• Organoid and Microphysiological Systems:

  • Rat organ-specific organoids for studying CCR5 function in tissue-specific contexts

  • Multi-organ-on-chip systems to investigate systemic effects of CCR5 signaling

  • These platforms bridge the gap between traditional cell culture and in vivo models

These emerging technologies are poised to transform our understanding of rat CCR5 biology and accelerate translation of findings to human health applications.

How might research on rat CCR5 contribute to understanding human inflammatory and infectious diseases?

Research on rat CCR5 has significant potential to advance our understanding of human inflammatory and infectious diseases through several key pathways:

• Comparative Receptor Biology:

  • Identification of conserved versus species-specific aspects of CCR5 function

  • Elucidation of fundamental mechanisms in chemokine signaling applicable across species

  • These insights help establish evolutionary principles in immune receptor function

• Translational Model Development:

  • Transgenic rats expressing human CCR5 provide platforms for studying HIV-1 pathogenesis

  • These models enable evaluation of antiviral strategies targeting CCR5

  • Findings from such models have already demonstrated successful infection by R5 HIV-1 strains with detection of viral DNA and gene products in lymphoid tissues

• Therapeutic Target Validation:

  • Rat models can validate CCR5 as a therapeutic target in inflammatory conditions

  • Studies in rats have shown that CCR5-mediated cellular recruitment contributes to transplant rejection and vascular diseases

  • These findings support development of CCR5 antagonists for human inflammatory conditions

• Biomarker Discovery:

  • Identification of CCR5-associated biomarkers in rat disease models

  • Correlation of CCR5 expression patterns with disease progression

  • Translation of biomarker panels for human diagnostic applications

The continued development of sophisticated rat models expressing CCR5 variants provides valuable tools for understanding complex human diseases and developing targeted therapeutic strategies.